ინფორმაცია

B13. რეზიუმე - ბიოლოგია

B13. რეზიუმე - ბიოლოგია



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

1. როდესაც ის მოძრაობს:

  • არხი არხი, ის ადგენს დასვენების პოტენციალს
  • ძაბვით დახურული არხი, ის ახდენს უჯრედის რეპოლარიზაციას მოქმედების პოტენციალის შემდეგ
  • არხი, რომელიც შემოიფარგლება ქიმიური მოდიფიკაციით (როგორიცაა ფოსფორილირება), მას შეუძლია მემბრანის ჰიპერპოლარიზაცია (შიგნით უფრო ნეგატიური გახადოს) და ხელი შეუწყოს ნეირონების ინჰიბირებას

2. თუ სიგნალიზაციაში ჩართულია ორი იონი, შედეგი დამოკიდებულია იმაზე

  • თუ ორი სახეობა ერთდროულად მოძრაობს ერთსა და იმავე არხზე (რაც იწვევს აგზნებას მემბრანის საწყისი დეპოლარიზაციის გზით, თუ იონები არის კალიუმი და ნატრიუმი)
  • თუ ორი სახეობა მოძრაობს სხვადასხვა არხზე თანმიმდევრულად (რაც წარმოქმნის მოქმედების პოტენციალს), თუ იონები არის კალიუმი და ნატრიუმი).

მოკლედ, ლიგანდი და ძაბვით შემოსაზღვრული არხები იძლევა მემბრანის პოლარიზაციის ცვლილებას. სხვა მექანიზმებმაც შეიძლება გამოიწვიოს ცვლილებები. მემბრანის ცილები შეიძლება ფოსფორილირდეს (ატფ-ის გამოყენებით) უჯრედში ცილოვანი კინაზებით, რაც იწვევს მემბრანის ცილის კონფორმაციის ცვლილებას და არხის გახსნას ან დახურვას. უჯრედების ციტოჩონჩხთან დაკავშირებული არხები ასევე შეიძლება გაიხსნას ან დაიხუროს გაჭიმვის გზით. კარიბჭის არხების სხვა სტიმულები არის სინათლე (ფოტოიზომერიზაციით გამოწვეული კონფორმაციული ცვლილებებით), სითბო და სიცივე.

კონტრიბუტორები

  • პროფესორი ჰენრი ჯაკუბოვსკი (სენტ ბენედიქტის კოლეჯი/სენტ ჯონის უნივერსიტეტი)

Smart Edu Hub

დედა მცენარე აწარმოებს ასობით რეპროდუქციულ ერთეულს, რომელსაც სპორები ეწოდება. როდესაც მცენარის ეს სპორის შემთხვევა იფეთქება, სპორები თავისუფლდება და ისინი მოძრაობენ ჰაერში და მიწაზე საკვებზე ან მიწაზე. აქ ისინი აღმოცენდებიან და ახალ მცენარეებს აწარმოებენ.

უსექსუალური გამრავლების უპირატესობები ველურ ბუნებაში და მოსავლის წარმოების სახეობებზე:

  • მშობლების ხელსაყრელი თვისებები გადაეცემა.
  • მკვრივი კოლონიები კონკურენციას უსწრებენ სხვა სახეობებს.
  • ნაკლები ენერგია/რესურსები გამოიყენება.
  • საჭიროა მხოლოდ ერთი მშობელი.
  • თუ მშობელი კარგად არის ადაპტირებული, მაშინ შთამომავლობა კარგად მოერგება გარემოს

ასექსუალური გამრავლების ნაკლოვანებები ველურ ბუნებაში და მოსავლის წარმოების სახეობებზე:

  • არის კონკურენცია რესურსებისთვის.
  • ვარიაცია მცირეა ან საერთოდ არ არის
  • ნაკლები ევოლუცია[ან] ნაკლები უნარი, მოერგოს ცვლილებას.
  • შესაძლებელია, რომ ყველა დაიღუპოს ერთი დაავადებით.

საბჭოს საგამოცდო კითხვა:
აღწერეთ გამრავლების პროცესი ბაქტერიებში: 3 ქულა

16.2: სქესობრივი რეპროდუქცია:

  • ᲡᲔᲥᲡᲣᲐᲚᲣᲠᲘ ᲠᲔᲞᲠᲝᲓᲣᲥᲪᲘᲐ:ეს არის პროცესი, რომელიც მოიცავს ორი გამეტის (სქესის უჯრედების) ორი ბირთვის შერწყმას ზიგოტის წარმოქმნით და შთამომავლობის წარმოქმნა გენეტიკურად განსხვავდება ერთმანეთისგან.
  • განაყოფიერება:ეს არის გამეტების ბირთვების შერწყმა.
  • გამეტის ბირთვები ჰაპლოიდურია
  • ზიგოტის ბირთვები დიპლოიდურია.

სქესობრივი გამრავლების უპირატესობები ცხოველთა სახეობებზე:

  • სახეობების პოპულაცია შეიძლება გაიზარდოს.
  • ის იძლევა ცვალებადობას სახეობებში, რაც გამოწვეულია დამოუკიდებელი ასორტიმენტით.
  • რეცესიული თვისებები ასევე შეიძლება გამოხატული იყოს.
  • ორგანიზმს შეუძლია უკეთ მოერგოს ცვალებად გარემოს.
  • ეს საშუალებას აძლევს სახეობების ევოლუციას.
  • არსებობს თესლის გაფანტვა
  • არის კოლონიზაცია

სქესობრივი გამრავლების უარყოფითი მხარეები ცხოველთა სახეობებზე:

სქესობრივი გამრავლების უარყოფითი მხარეები მცენარის სახეობებზე

  • სჭირდება ორი მშობელი [ან] სჭირდება დამბინძურებელი აგენტი.
  • ბევრი მტვერი იკარგება [ან ბევრი თესლი იკარგება]
  • განაყოფიერება შეიძლება არ მოხდეს
  • არსებობს დიდი ენერგიის დაკარგვა

16.3: სქესობრივი გამრავლება მცენარეებში:

მწერების დამბინძურებელი ყვავილის ნაწილები:

შემდეგი ფუნქციებია:

  • სეპალები: ის იცავს ყვავილს კვირტის მდგომარეობაში
  • ფურცლები: მწერებით დამტვერიან ყვავილებში მისი ფუნქციაა მწერების მოზიდვა.
  • ანტერები: სასქესო უჯრედების წარმოქმნა
  • სტიგმები ეს არის ყვავილის მდედრი ნაწილის ზედა ნაწილი და მისი ფუნქციაა მტვრის მარცვლების შეგროვება.
  • საკვერცხეები: მისი ფუნქციაა ქალის სასქესო უჯრედების წარმოება

მწერების დაბინძურებული და ქარით დამტვერილი ყვავილების მახასიათებლების შედარება:

  • ყვავილები მუქი მწვანე ან ყავისფერია ან არაფერადი
  • არის პატარა ფურცლები [ან] ფურცლების ნაკლებობაა
  • ყვავილები პატარაა ან შეუმჩნეველი
  • ფრჩხილები არის ყოფნა
  • ძაფები გრძელია
  • ანტერები/სტიგმები ჩამოკიდებულია ყვავილებიდან
  • ანტერები თავისუფლად არის მიმაგრებული
  • სტიგმები ჩამოკიდებულია ყვავილებიდან
  • სტიგმები ბუმბულია
  • სტიგმას აქვს დიდი ზედაპირი
  • წარმოიქმნება დიდი რაოდენობით მტვერი.
  • ნექტარი არ არის
  • ყვავილებს სუნი არ აქვთ

ქარის დამბინძურებელი ყვავილების მტვერის მახასიათებლები:

  • მტვერი მსუბუქია
  • მტვერი არის წებოვანი/გლუვი
  • მტვერს აქვს დიდი ზედაპირი
  • წარმოიქმნება დიდი რაოდენობით მტვერი
  • მტვერი პატარაა

თვით და ჯვარედინი დამტვერვა:

სქესობრივი გამრავლება ადამიანებში:

1. მამაკაცის რეპროდუქციული სისტემის ეტიკეტირებული დიაგრამა

მამაკაცის რეპროდუქციული სისტემის 2 ნაწილი და ფუნქციები:

  • პენისი - სპერმის შეყვანა საშოში
  • ურეთრა - სპერმის გადატანა პენისიდან
  • ტესტოსტერონი - სპერმის წარმოება (ტესტოსტერონი)
  • VAS DEFERENS (სპერმის სადინარი) - სპერმის გადატანა სათესლედან ურეთრაში
  • SROTUM - სათესლე ჯირკვლის შენარჩუნება სხეულის ტემპერატურაზე დაბალ ტემპერატურაზე
  • პროსტრატის ჯირკვალი - სათესლე სითხის წარმოებისთვის
  • ეპიპიდიმუსი - სპერმის შესანახად

3. ქალის რეპროდუქციული სისტემის ეტიკეტირებული დიაგრამა

4. ქალის რეპროდუქციული სისტემის სტრუქტურა და ფუნქციები

  • საკვერცხეები - ესტროგენისა და პროგესტერონის ჰორმონების გამომუშავება/ ის ასევე არის კვერცხუჯრედის განვითარებისა და ოვულაციის ადგილი
  • ფალოპის მილები - (კვერცხუჯრედები) - კვერცხუჯრედის გადატანა საკვერცხედან საშვილოსნომდე
  • საშვილოსნო - ემბრიონის და ნაყოფის განვითარების ადგილი
  • ცერვიქსი- ჩართულია მენსტრუაციაში/ აკავებს ნაყოფს ორსულობისას/ დილატირდება მშობიარობის დროს, რათა ნაყოფმა დატოვოს საშვილოსნო.
  • ვაგინა-უზრუნველყოფს სპერმის და მენსტრუალური ნაკადის გასასვლელს/ ის ასევე მოქმედებს როგორც დაბადების არხი

5 პლაცენტის როლი ორსულობის შენარჩუნებაში:

  • ის გამოყოფს პროგესტერონს, რათა შეინარჩუნოს საშვილოსნოს ლორწოვანი გარსი სქელი, ორსულობის შესანარჩუნებლად, რათა თავიდან აიცილოს საშვილოსნოს ლორწოვანი გარსის დაშლა.

6. პლაცენტის როლი ნაყოფის განვითარებაში: დაფის კითხვა-4მ

  1. მასალების გაცვლა მაგ. ჟანგბადი / გლუკოზა / წყალი / ამინომჟავები / ანტისხეულები / შარდოვანა / ნახშირორჟანგი
  2. მოქმედებს როგორც ფიზიკური მიმაგრება ნაყოფსა და საშვილოსნოს/დედას შორის
  3. ხელს უშლის დედისა და ნაყოფის სისხლის შერევას
  4. იცავს დედის და (მაღალი) არტერიული წნევისგან
  5. თამაშობს დამცავ როლს ზოგიერთი პათოგენის A შეღწევის თავიდან ასაცილებლად
  6. ის ფარავს პროგესტერონს საშვილოსნოს ლორწოვანი გარსის სქელ შესანარჩუნებლად/აფერხებს მენსტრუაციას/საშვილოსნოს ლორწოვანის დაშლის თავიდან ასაცილებლად ან საშვილოსნოს კუნთების შეკუმშვას.

პლაცენტის 7 ფუნქცია

  • ის მოქმედებს როგორც ბარიერი სისხლის სისტემებს შორის და ამით ხელს უშლის დედისა და ნაყოფის სისხლის შერევას.
  • ის აწვდის ნაყოფს ჟანგბადს
  • ის მხარს უჭერს ნაყოფს
  • ის იცავს უეცარი მოძრაობებისა და მუწუკებისგან
  • ეს ხელს უწყობს ნახშირორჟანგისა და შარდოვანას ნაყოფის მოცილებას
  • ეს ხელს უწყობს დედისგან ანტისხეულების გადატანას
  • ეს ხელს უწყობს წყლის მიწოდებას და ამოღებას

8. მასალების გაცვლა პლაცენტაში

დედიდან ნაყოფზე გადადის შემდეგი ნივთიერებები:

  • ჟანგბადი
  • გლუკოზა
  • Ამინომჟავების
  • ლიპიდები/ფატუ მჟავები და გლიცერინი
  • ვიტამინები
  • იონები (Na, Ca, Fe_
  • ალკოჰოლი, ნიკოტინი და სხვა პრეპარატები
  • ვირუსები
  • ანტისხეულები

ნაყოფიდან დედაზე გადადის შემდეგი ნივთიერებები:

8. ამნიოტური სითხისა და ამინიოტიკური ტომრის ფუნქციები: დაფის კითხვა-[2 ნიშანი]

ამნიოტური სითხე::

  1. იცავს ნაყოფს ფიზიკური დაზიანებისგან/ბალიშებისგან
  2. ის მოქმედებს როგორც ამორტიზატორი AW უარყოფილი პასუხი: ხელს უშლის შოკს / უზრუნველყოფს მხარდაჭერას
  3. ხელს უშლის ნაყოფზე არათანაბარი ზეწოლის მოქმედებას/
  4. ინარჩუნებს მუდმივ გარემოს / იძლევა თავისუფალ მოძრაობას
  5. იცავს ნაყოფს ტემპერატურის რყევებისგან REJECTED insulates
  6. იცავს ნაყოფს გამოშრობისგან

ამნიოტური ტომარა:

  1. გამოყოფს/წარმოქმნის ამნიონურ სითხეს
  2. აკრავს/შეიცავს ამნიონურ სითხეს

ზემოაღნიშნული pdf-ების სრული ნაკრები ჩვენი წევრობის ვებსაიტზე: ბმული

9.ბავშვი-დაბადება

10.დაბადების კონტროლის მეთოდები-დაფა-კითხვა-12ნიშანი

  • ბუნებრივი:
  1. ეს არის რიტმის მეთოდი ან კალენდარული მეთოდი. მნიშვნელოვანია იცოდეთ მენსტრუალური ციკლის ნიმუში. როდესაც კვერცხუჯრედი კვერცხუჯრედშია, არ უნდა მოხდეს სქესობრივი კავშირი. ოვულაციის ერთ-ერთი მაჩვენებელია სხეულის ტემპერატურის მატება.
  2. შემდეგი ბუნებრივი მეთოდია პენისის ამოღება საშოდან ეაკულაციამდე, რათა თავიდან აიცილოს სპერმის კვერცხუჯრედთან კონტაქტი.
  3. ბოლო ბუნებრივი მეთოდია სექსისგან თავის შეკავება ორსულობის თავიდან ასაცილებლად
  • ქიმიური:
  1. კონტრაცეპტული აბები, რომლებიც შეიცავს პროგესტერონს და ესტროგენს, ხელს უშლის ოვულაციას
  2. დილის შემდეგ აბი: ეს აბი ხელს უშლის განაყოფიერებული კვერცხუჯრედის იმპლანტაციას საშვილოსნოში
  3. საშოზე წასმული სპერმიციდული კრემი კლავს სპერმას
  • მექანიკური:
  1. პრეზერვატივის გამოყენება ხელს უშლის სპერმის კვერცხუჯრედთან კონტაქტს
  2. IUD-ის გამოყენება ხელს უშლის განაყოფიერებული კვერცხუჯრედების იმპლანტაციას საშვილოსნოში
  • ქირურგიული:

ვაზექტომია/ლაპაროტამია: ვაზექტომიის დროს კვერცხუჯრედები იჭრება და ილუქება, ხოლო ლაპაროტამიის დროს სპერმის სადინრები იჭრება ისე, რომ კვერცხუჯრედს არ შეუძლია სპერმის გავლა.


პასუხები კერბოდლის ყველა სამუშაოზე AQA GCSE

არ ვიცი, გულისხმობთ თუ არა კითხვებს Kerboodle-ის სახელმძღვანელოებიდან, მაგრამ აქ არის ბმული ყველა AQA Gcse მეცნიერების სახელმძღვანელოსთვის, რომელიც გავრცელდა პასუხების ბოლოს. მათ ასევე აქვთ პასუხები გვერდის ბოლო კითხვებზე.

(ორიგინალური პოსტი ამიგრაცემი.x)
არ ვიცი, გულისხმობთ თუ არა Kerboodle-ის სახელმძღვანელოების კითხვებს, მაგრამ ეს არის ბმული ყველა AQA Gcse მეცნიერების სახელმძღვანელოსთვის, რომლის ბოლოა გავრცელებული პასუხები. მათ ასევე აქვთ პასუხები გვერდის ბოლო კითხვებზე.

Სწრაფი პასუხი

დაკავშირებული დისკუსიები

  • Kerboodle პასუხები
  • GCSE ქიმიის AQA სახელმძღვანელოს პასუხები
  • Kerboodle AQA ესპანური უმაღლესი წიგნის პასუხები
  • AQA GCSE Physics მესამე გამოცემა წიგნი - სად მივიღოთ პასუხები?
  • Kerboodle Physics სექციის ბოლოს პასუხები?
  • კერბუდლი
  • AQA Triple Science გადასინჯვის სახელმძღვანელო - არის CGP ოქროს სტანდარტი?
  • Kerboodle სახელმძღვანელოს პასუხები
  • დახმარება! ვფიქრობ კერბოდლში შეერთებაზე. ღირს?
  • AQA გამოცდის სტილის კითხვები პასუხები A2
  • აჩვენე კიდევ 10
  • AQA როგორც ესპანური სახელმძღვანელოს პასუხები
  • AQA ფრანგული
  • იანვრის შემდეგ ფიზიკაში არაფერი მისწავლია და ახლა ვგიჟდები
  • GCSE French HELP!!
  • ააა დონის მათემატიკა
  • Kerboodle სასარგებლოა
  • AQA A-Level ბიოლოგიის შენიშვნები
  • საუკეთესო სახელმძღვანელო ქიმიისთვის
  • როგორ მოიქცეთ კარგად თქვენს GCSE-ზე
  • AQA A ფიზიკა A2 სახელმძღვანელოს დამატებითი რესურსები

Დაკავშირებული სტატიები

უი, არავის გამოუქვეყნებიაბოლო რამდენიმე საათში.

რატომ არ დაიწყო საუბარი ხელახლა?

  • HMRC საგადასახადო სპეციალისტის პროგრამა 2021 წ
  • ამ საიტზე ბევრი რასისტია
  • St George's A100 Medicine Reference
  • ესკორტი ოქსფორდი
  • გახადე ეს უფრო თმის ვარცხნილობა !!
  • გადადით სოციალური მუშაობის კოჰორტაზე 7 2022
  • ჩემი ბებია და ბაბუა.
  • UCLAN მიმღებები
  • კრიპტოვალუტა კარგი ინვესტიციაა?
  • ჰკითხეთ ლონდონის საიმპერატორო კოლეჯის სტუდენტს!
  • Detective Constable შეხვდა პოლიციის Grad სქემა
  • საუთჰემპტონის ოკეანოგრაფია
  • ოქსფორდის ინგლისური ენა და ლიტერატურა წლის 2 საკითხავი სია
  • მეგობრების შექმნა uni
  • ოქსფორდის ასპირანტურის მიმტანი 2021 წელი
  • Barclays უმაღლესი/სამაგისტრო სტაჟირება - 2021 წ
  • სასაზღვრო ძალების EO (სამხრეთ აღმოსავლეთი) 2021 წლის აპრილი
  • მისი ჰერფესტია
  • მედიცინის (A100) ლოდინის სია 2021 წ
  • ამ საიტზე ბევრი რასისტია

უი, პოსტებს არავინ პასუხობს.

რატომ არ უპასუხე უპასუხო თემას?

  • მიმდინარე წლის 11 ჩეთის თემა (2020-2021)
  • Physics gcse aqa ქაღალდი 1 2020 წ
  • მიმდინარე წლის 10 ჩატის თემა (2020-2021)
  • მასწავლებელი აფასებდა ქულებს
  • მითხარი
  • 2021 წლის AQA საგამოცდო მასალები გაჟონა.
  • ინგლისურენოვანი ნაშრომი 1 სამშაბათი, 2 ივნისი, 2020 წ
  • AQA Chemistry ქაღალდი 1 უმაღლესი 2020
  • GCSE 2020 Physics Paper 1 AQA
  • ინგლისური ენის ნაშრომი 2 ივნისი 2020 წ
  • უფროსი ბიჭის გამოსვლა. Იდეები?
  • ფიზიკის ქაღალდი 1 2019 aka gcse
  • AQA ბიოლოგიის ნაშრომი 1 ნოემბერი 2020!
  • ინგლისური ნაშრომი 1 ნოემბერი 2019 მარკის სქემა
  • მე დავკარგე ჩემი GCSE სერთიფიკატები!! Რა გავაკეთო??
  • პრეფექტების ინტერვიუებში დასმული კითხვები
  • GCSE-ის გადასვლის ყველაზე სწრაფი გზა (მოწიფული ზრდასრული - კურსების გარეშე)
  • იმიტირებული შედეგები ფაქტობრივი GCSE-ების წინააღმდეგ
  • წარსული ნაშრომები
  • 2020 წლის გამოცდა დასცინის აქა | ინგლისური ენა/ისტორია | ედექსელის მათემატიკა

იხილეთ მეტი რა მოგწონთსტუდენტური ოთახი

თქვენ შეგიძლიათ პერსონალურად მოახდინოთ ის, რასაც ხედავთ TSR-ზე. გვიამბეთ ცოტა თქვენს შესახებ, რომ დავიწყოთ.

Გინახავს.

Y12's - დაიწყეთ თუ არა დაგეგმვა, რისი გაკეთება გსურთ Y13-ის შემდეგ?

უყურე თემებს

ყურადღების ცენტრში

უი, არავის გამოუქვეყნებიაბოლო რამდენიმე საათში.

რატომ არ დაიწყო საუბარი ხელახლა?

უი, პოსტებს არავინ პასუხობს.

რატომ არ უპასუხე უპასუხო თემას?

იხილეთ მეტი რა მოგწონთსტუდენტური ოთახი

თქვენ შეგიძლიათ პერსონალურად მოახდინოთ ის, რასაც ხედავთ TSR-ზე. გვიამბეთ ცოტა თქვენს შესახებ, რომ დავიწყოთ.

TSR მხარდაჭერის გუნდი

  • RDKGames
  • charco
  • The Confused Medic
  • ბატონი მ
  • ლემური14
  • გონების სიტყვა
  • ლაბრადორი99
  • აბსოლუტურად აყვავებული
  • ეიმანუელი
  • სინოჰ
  • _gcx
  • ბარორი 1
  • ტოლგაშ
  • ჰეზელი
  • პატარა პანდა
  • _Mia101
  • jduxie4414
  • ვარსკვლავის შუქი 15
  • ბამტუტორი

Დაიწყე

TSR-ის გამოყენება

TSR ჯგუფი

დაუკავშირდით TSR-ს

© Copyright The Student Room 2017 ყველა უფლება დაცულია

The Student Room, Get Revising and Marked by Teachers შპს The Student Room Group-ის სავაჭრო სახელებია.

რეგისტრაციის ნომერი: 04666380 (ინგლისი და უელსი), დღგ No. 806 8067 22 რეგისტრირებული ოფისი: International House, Queens Road, Brighton, BN1 3XE


გენომის შედარებითი ანალიზი პseudomonas knackmussii B13, პირველი ბაქტერია, რომელიც ცნობილია ქლოროარომატიული ნაერთების დეგრადაციაში

seudomonas knackmussii B13 იყო პირველი შტამი, რომელიც იზოლირებული იყო 1974 წელს, რომელსაც შეეძლო ქლორირებული არომატული ნახშირწყალბადების დაშლა. ეს აღმოჩენა იყო მრავალი ბაქტერიული მეტაბოლური გზების შემდგომი დახასიათების პროლოგი, გენეტიკური და ბიოქიმიური კვლევებისთვის და რამაც გააჩინა იდეები დამაბინძურებლების ბიორემედიაციის შესახებ. ამ კვლევაში ჩვენ დავადგინეთ B13-ის გენომის სრული თანმიმდევრობა შემდეგი თაობის თანმიმდევრობის ტექნოლოგიებისა და ოპტიკური რუქების გამოყენებით. გენომის ანოტაცია მიუთითებს, რომ B13-ს აქვს სხვადასხვა მეტაბოლური გზა მონოარომატული ნახშირწყალბადების დეგრადაციისთვის, მათ შორის ქლორბენზოატი, ამინოფენოლი, ანტრანილატი და ჰიდროქსიქინოლი, მაგრამ არა პოლიარომატული ნაერთები. გენომის შედარებითი ანალიზმა აჩვენა, რომ B13 ყველაზე ახლოს არის seudomonas denitrificans და seudomonas aeruginosa. B13 გენომი შეიცავს სულ მცირე რვა გენომურ კუნძულს [პროფაგებს და ინტეგრაციულ კონიუგატიურ ელემენტებს (ICEs)], რომლებიც არ იყო მჭიდროდ დაკავშირებულ ფსევდომონადებში. ჩვენ ვადასტურებთ, რომ ორი ICE არის ICE 103 კბ თვითგადამცემი ელემენტის იდენტური ასლიclc რომელიც ატარებს ქლოროკატექოლის მეტაბოლიზმის გენებს. ICE-ს შედარებაclc აჩვენა, რომ იგი შედგება ცვლადი და „ბირთვი“ რეგიონისგან, რომელიც ძალიან კონსერვირებულია პროტეობაქტერიულ გენომებს შორის, რაც მიუთითებს ჯერჯერობით დაუხასიათებელი ICE-ის ფართოდ გავრცელებულ ოჯახზე. ორი სპონტანური B13 მუტანტის განმეორებით გამოვლენამ გამოავლინა რამდენიმე ერთი ნუკლეოტიდის ჩანაცვლება, ასევე დიდი 220 კბ რეგიონის ამოკვეთა და პროფაგი, რომელიც მკვეთრად ცვლის მასპინძლის მეტაბოლურ შესაძლებლობებს და გადარჩენას.

ნახ. S1. B13 გენომის დე ნოვო შეკრების შემოწმება ოპტიკური რუკების საშუალებით. SOAPdenovo (kmer = 43) ან Velvet (kmer = 35) მიერ გენერირებული კონტიგები გასწორდა ოპტიკურ რუკაზე (მომზადებული KpnI-სთვის). Velvet-ის მიერ არასწორად აწყობილი სამი რგოლი მითითებულია შავი ისრისპირებით. საბოლოო B13 გენომი დამოწმებული იყო იმავე შეზღუდვის ფერმენტისთვის ოპტიკური რუქით. გაითვალისწინეთ, თუ როგორ არის ორი ICEclc ასლები იშლება თავდაპირველ რუკაში (წითელი), მაგრამ გამოჩნდება დუბლიკატად საბოლოო შესწორებულ ოპტიკურ რუკაზე.

ნახ S2. B13 გენომის კუმულაციური GC-დახრილობა. პოზიცია +1 შეესაბამება რეპლიკაციის სავარაუდო საწყისს (oriC), ხოლო რეპლიკაციის სავარაუდო დასრულების ადგილი (ტერ) მითითებულია ისრით. ყურადღება მიაქციეთ, თუ რამდენად გრძელია მარჯვენა რეპლიქორი მარცხენაზე ორი ICE-ის არსებობის გამოclc ასლები.

ნახ S3. USR1-ის არასტაბილურობის PCR ანალიზი B13-ში. დნმ B13 კულტურებიდან MM-ში 5 მმ 3-CBA-ით 7, 14, 21, 28 და 35 თაობის შემდეგ გამოიყენებოდა PCR-ში. სურათებზე ნაჩვენებია USR1-ის 1,6 კბ მარცხენა საზღვრის ამპლიკონები (PKB_2522-სა და PKB_2524-ს შორის) და 1,5 კბ შეერთების PKB_2522-სა და PKB_2737-ს შორის, რომელიც წარმოიქმნება USR1-ის დაკარგვით. B13-4492 და B13-4493 არის ორი მუტანტი სინგლით parB წაშლა. N, პ.პუტიდა KT2440 კულტურა გამოყენებული, როგორც უარყოფითი კონტროლი M, Mass-ruler DNAladder (Fermentas). გაითვალისწინეთ, თუ როგორ ყველა კულტურის გარდა პ.პუტიდა გააძლიერეთ მარცხენა საზღვარი (მაღალი რაოდენობით) და შეერთება (დაბალი რაოდენობით), რაც მიუთითებს იმაზე, რომ უჯრედების მცირე ნაწილმა დაკარგა USR1 რეკომბინაციის შედეგად.

ნახ S4. ფლაგელარული ასოცირებული გენების შედარება B13-ის USR1-ში ორთოლოგურ გენებთან სხვა ფსევდომონადების გენომებში. რუქებზე ნაჩვენებია გენომის შესაბამისი რეგიონები (გამოსახულია კოორდინატები) პროგნოზირებული გენების მდებარეობით, როგორც ღია ან ფერადი ხუთკუთხედები (გენის მიმართულების მითითებით). გენების დამაკავშირებელი ფერადი ზოლები აჩვენებს ამინომჟავების პროცენტულ მსგავსებას, რომელიც გამოითვლება GenomeMatcher-ში Blastp-ის შედარებით, ფერის მასშტაბის მიხედვით. გენების ფერები B13 რეგიონში USR1 ეხება გენის ფუნქციებს, რომლებიც ნახსენებია 5-ში.

ცხრილი S1. გენომების ასამბლეის სტატისტიკა Pseudomonas knackmussii B13 და მისი მუტანტები.

ცხრილი S2. B13 გენომში პოტენციური პროფაგური რეგიონების სილიკო პროგნოზირება PHAST-ით.

ცხრილი S3. ICE-ის პროგნოზირებული გენის ფუნქციები ICE-ის მსგავსიclc ხუთ პროტეობაქტერიულ გენომში.

ცხრილი S4. საყოფაცხოვრებო გენები, რომლებიც გამოიყენება ფილოგენეტიკურ ანალიზში.

გთხოვთ გაითვალისწინოთ: გამომცემელი არ არის პასუხისმგებელი ავტორების მიერ მოწოდებული ნებისმიერი დამხმარე ინფორმაციის შინაარსზე ან ფუნქციონალურობაზე. ნებისმიერი შეკითხვა (გარდა გამოტოვებული შინაარსისა) უნდა მიემართოს სტატიის შესაბამის ავტორს.


ფარმაკოლოგიურად მიზნად ისახავს ხარაჩოს ​​პროტეინის FRS2α მირისტოილაციას აინჰიბირებს FGF/FGFR შუამავლობით ონკოგენურ სიგნალიზაციას და სიმსივნის პროგრესირებას

ფიბრობლასტური ზრდის ფაქტორის (FGF)/FGF რეცეპტორის (FGFR) სიგნალიზაცია ხელს უწყობს სიმსივნის დაწყებას და პროგრესირებას. მიუხედავად იმისა, რომ ამჟამად დამტკიცებულმა FGFR კინაზას ინჰიბიტორებმა აჩვენეს თერაპიული სარგებელი კლინიკურ კვლევებში, FGFR-ების გადაჭარბებული გამოხატვა ან მუტაციები საბოლოოდ იწვევს წამლის რეზისტენტობას და ამით აუქმებს კინაზას ინჰიბიტორების სასურველ აქტივობას კიბოს ბევრ ტიპში. ამ კვლევაში ჩვენ ვატყობთ, რომ ფიბრობლასტური ზრდის ფაქტორის რეცეპტორის სუბსტრატის 2 (FRS2α) მირისტოილაციის დაკარგვა, ხარაჩოის პროტეინი, რომელიც აუცილებელია FGFR სიგნალიზაციისთვის, აინჰიბირებს FGF/FGFR შუამავლობით ონკოგენურ სიგნალიზაციას და FGF10-ით გამოწვეულ სიმსივნურ გენეზს. გარდა ამისა, ადრე სინთეზირებული myristoyl-CoA ანალოგი, B13, რომელიც მიზნად ისახავს -მირისტოილტრანსფერაზები, თრგუნავენ FRS2α მირისტოილირებას და ამცირებენ ფოსფორილირებას FRS2α ლოკალიზაციის მსუბუქი შეცვლით უჯრედულ მემბრანაზე. B13 თრგუნავს ონკოგენურ სიგნალიზაციას, რომელიც გამოწვეულია WT FGFR-ებით ან მათი წამლისადმი რეზისტენტული მუტანტებით (FGFRs DRM). B13 მარტო ან FGFR ინჰიბიტორთან ერთად თრგუნავს FGF-ით ინდუცირებულ WT FGFR- ან FGFR DRM-ის ინიცირებულ ფოსფოინოზიტიდ 3-კინაზას (PI3K) აქტივობას ან MAPK სიგნალიზაციას, იწვევს უჯრედული ციკლის გაჩერებას და ამით აფერხებს უჯრედების პროლიფერაციას და კიბოს რამდენიმე ტიპს. დაბოლოს, B13 მნიშვნელოვნად აფერხებდა ქსენოტრანსპლანტატი სიმსივნეების ზრდას ღვიძლის, თირკმელების ან ფილტვებისთვის პათოლოგიური ტოქსიკურობის გარეშე. in vivo შეჯამებით, ჩვენი კვლევა გვთავაზობს შესაძლო თერაპიულ მიდგომას FGF/FGFR შუამავლობით კიბოს პროგრესირების და წამლისადმი რეზისტენტული FGF/FGFR მუტანტების ინჰიბირების მიზნით.

საკვანძო სიტყვები: B13 FRS2 კიბოს წამლის მოქმედების ფიბრობლასტური ზრდის ფაქტორი (FGF) ფიბრობლასტური ზრდის ფაქტორის რეცეპტორების (FGFR) მირისტოილაციის ცილის აცილაცია.

© 2018 ბიოქიმიისა და მოლეკულური ბიოლოგიის ამერიკული საზოგადოების მიერ, Inc.

ინტერესთა კონფლიქტის განცხადება

ავტორები აცხადებენ, რომ მათ არ აქვთ ინტერესთა კონფლიქტი ამ სტატიის შინაარსთან


Ექსპერიმენტული პროცედურები

ზრდის პირობები და გენომიური დნმ-ის იზოლაცია

Pseudomonas knackmussii B13 და მისი წარმოებულები კულტივირებული იყო ტიპის 21C MM-ში (Gerhardt და სხვ., 1981) დაემატა ან 3-CBA (5 მმ), ან ფენილაცეტატი (5 მმ), როგორც ერთადერთი ნახშირბადი და ენერგიის წყარო. B13, B13-2201 და B13-2811 გენომიური დნმ იზოლირებული იყო კულტურებიდან ექსპონენციალურ ფაზაში MM-ში 3-CBA ზემოთ აღწერილი მეთოდის გამოყენებით (Sentchilo და სხვ., 2009 ).

თანმიმდევრობა

Pseudomonas knackmussii B13 ველური ტიპის და მუტანტური დნმ-ის თანმიმდევრობის ბიბლიოთეკები ჩანართის საშუალო ზომით 0,5 კბ მომზადდა Aird-ის მეთოდით. და სხვ. (2011) Accuprime HF პოლიმერაზასა და ბეტაინის გამოყენებით PCR გამაძლიერებელი ბუფერში. თითოეული ბიბლიოთეკის თანმიმდევრობა განხორციელდა 38- და 76-ნუკლეოტიდური PE პროტოკოლების გამოყენებით ნაკადის უჯრედის ერთ ხაზში, Illumina GAII-ის თანმიმდევრობის პლატფორმის გამოყენებით. ნედლეული მონაცემები დამუშავდა Illumina მონაცემთა დამუშავების მილსადენის v1.60-ის გამოყენებით და ექსპორტირებული იყო fastq ფაილების სახით. B13 ველური ტიპის გენომისთვის, მომზადდა დამატებითი 5 კბ ჩანართის ბიბლიოთეკა და დახარისხდა Pacific Biosciences RS-ზე ორ SMRT უჯრედზე მწარმოებლის (Pacific Biosciences) მეთოდების მიხედვით.

გენომის შეკრება

ექსპორტირებული 38- და 76-ნუკლეოტიდური PE წაკითხულის ხარისხი კონტროლდებოდა fastqc-ის გამოყენებით (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/). არა-B13 დამაბინძურებლების წაკითხვები გაფილტრული იყო შიდა Perl სკრიპტის გამოყენებით. საჭიროების შემთხვევაში, წაკითხულის ამოღება ხდებოდა 5′ ან 3′ ბოლოზე ან ორივეზე დაბალი ხარისხის საბაზისო გამოძახების მოსაშორებლად.

გაწმენდილი წაკითხული აწყობილი იყო CLCBio (www.clcbio.com), AbySS (Simpson) გამოყენებით და სხვ., 2009), Velvet (Zerbino and Birney, 2008) ან SOAPdenovo (Li და სხვ., 2010), სხვადასხვა კმერ-პარამეტრების გამოყენებით (მხარდამჭერი ინფორმაციის ცხრილი S1).

OpGen ოპტიკური რუკა

B13 გენომიური დნმ-ის ოპტიკური რუკა რესტრიქციული ფერმენტისთვის KpnI შეიქმნა OpGen-ის მიერ (მერილენდი, აშშ). რუკა გამოიყენებოდა პროგრამაში MapSolver (OpGen) ოთხი სხვადასხვა ასამბლეის პროგრამის მიერ წარმოქმნილი კონტიგების სწორად პოზიციონირებისთვის. ჩვენ ავირჩიეთ SOAPdenovo-ს მიერ გენერირებული კონტიგები, როგორც საუკეთესო ხარისხის ასამბლეა და დავამზადეთ კონტიგები რუკის მიხედვით (დამხმარე ინფორმაცია სურ. S2).

გენომის დასრულება

B13 ველური ტიპის გენომის მონახაზი შეიკრიბა SOAPdenovo ხარაჩოების და PacBio წაკითხვის კომბინაციით და შემდგომ დამოწმებული მულტიპლექსური PCR-ით. მულტიპლექს PCR-ში შესამოწმებელი პრაიმერები B13 გენომიური დნმ-ის გამოყენებით შეირჩა 400 bp-დან ორივე კონტიგური და ხარაჩოს ​​ბოლოებიდან Consed (გორდონი) გამოყენებით და სხვ., 1998), R (http://www.R-project.org) და შიდა სცენარი. პოზიტიური PCR პროდუქტები გაწმენდილი და თანმიმდევრული იყო Sanger-ის სტანდარტული ტექნოლოგიის გამოყენებით და თანმიმდევრობა გამოიყენებოდა ყველა ხარვეზის დასაფარად. შემდეგ დადასტურდა გენომის სრული თანმიმდევრობის პროექტი ყველა ინდივიდუალური წაკითხვის ხელახალი რუქაზე და საბოლოო შეუსაბამობების ამოღებით PrInSeS (Massouras) გამოყენებით და სხვ., 2010). საბოლოო უფსკრული B13 გენომის თანმიმდევრობა გადაეგზავნა ევროპის ნუკლეოტიდების არქივს და ხელმისაწვდომია დაშვების ნომრით HG322950.

Ანოტაცია

The P. knackmussii B13 გენომის თანმიმდევრობა ავტომატურად იყო ანოტაცია GenDB-ის გამოყენებით (Meyer და სხვ., 2003). ფუნქციური ანოტაცია მიღებული იყო BLAST-დან (Altschul და სხვ., 1997) თანმიმდევრობის მსგავსების ძიება Swiss-Prot/UniProtKB-თან (UniProt, 2012), ისევე როგორც RefSeq (Pruitt) და სხვ., 2012). იმ შემთხვევაში, თუ ძლიერი მსგავსება არ იყო გამოვლენილი, BLAST-ის შედეგები ხელით გაანალიზებული იყო არაზედმეტად NCBI მონაცემთა ბაზასთან, KEGG-თან (Kanehisa) და სხვ., 2012) ან COG-ს (ტატუსოვი და სხვ., 2000), ასევე ფარული მარკოვის მოდელის ძიების საშუალებით Pfam-ის წინააღმდეგ (ფინ. და სხვ., 2008 ) და TIGRFAM მონაცემთა ბაზები (Haft და სხვ., 2003). სახელმძღვანელო ანოტაციები განსაკუთრებით ფოკუსირებული იყო პოტენციურ GI რეგიონებზე, USR1 რეგიონზე, ფლაგელარულ გენებზე და არომატული ნაერთების დეგრადაციის მეტაბოლურ გზებზე.

ფილოგენეტიკური ანალიზი

16S rRNA გენების ნუკლეოტიდური თანმიმდევრობები 12-დან ფსევდომონასი სახეობის პლუსი ეშერიხია კოლი MG1655, როგორც გარე ჯგუფი, ამოღებულია NCBI მონაცემთა ბაზიდან. თანმიმდევრობები გასწორდა MUSCLE პროგრამასთან (https://www.ebi.ac.uk/Tools/msa/muscle/) და მაქსიმალური ალბათობის (ML) ხე რეკონსტრუირებული იყო MEGA 5.2.2-ის გამოყენებით Tamura-Nei-სთან ერთად. მოდელი და უახლოესი მეზობელი-გადაცვლა (NNI), შემდგომში გამოიყენება 1000 ჩამტვირთავი რეპლიკა (ტამურა და სხვ., 2011). 20 კონსერვირებული საყოფაცხოვრებო გენის ამინომჟავების თანმიმდევრობა (მხარდამჭერი ინფორმაციის ცხრილი S4), რომლებიც მიჩნეულია, რომ არ იყო ჰორიზონტალურად გადატანილი (Ciccarelli და სხვ., 2006), შეირჩა Microscope Genoscope-დან (http://www.genoscope.cns.fr/agc/microscope/home/). ამინომჟავების თანმიმდევრობები გასწორდა MUSCLE-სთან და შეერთდა შიდა სკრიპტის დახმარებით. ფილოგენეტიკური ხე რეკონსტრუირებული იყო ML მეთოდის გამოყენებით Jones-Taylor-Thornton მოდელით, NNI მოძრაობით და 100 bootstrap რეპლიკატით.

თანმიმდევრობის შედარება

B13 გენომები შეადარეს სილიკოში სხვა ფსევდომონადებს პროგრამული უზრუნველყოფის BRIG (ალიხანის) გამოყენებით და სხვ., 2011), ARTEMIS (Rutherford და სხვ., 2000) და GenomeMatcher (Ohtsubo და სხვ., 2008). პოტენციური ICEclc ჰომოლოგიური რეგიონები სხვა ბაქტერიულ გენომებში გამოვლინდა MegaBlast-ის გამოყენებით (http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome). შემდეგ ცალკეული ჰიტები იქნა მოძიებული და ხელით მოძებნილი ICE-ის არსებობის შესახებclc დამახასიათებელი გენები, როგორიცაა ინტეგრაზა, tRNA Gly-ს გენი და გენები parB-shi-parA-alpA, რომლებიც განლაგებულია ICE-ს მეორე ბოლოსთან ახლოსclc (ნახ. 4A). სავარაუდო ICE რეგიონები იზოლირებული იყო სილიციუმში მასპინძლის გენომიდან და წყვილში ICE-თან შედარებითclc WebACT-ის გამოყენებით (http://www.webact.org/WebACT/home). 80%-ზე მეტი ნუკლეოტიდური თანმიმდევრობის მსგავსების მქონე რეგიონები იყო ექსპორტირებული და ნაჩვენები ადგილობრივ გენის რუკაზე DNAPlotter-ის (Carver) გამოყენებით და სხვ., 2009). საბოლოო ჩვენება რედაქტირებულია Adobe Illustrator CS6-ში სიცხადისთვის. ნუკლეოტიდური პოლიმორფიზმი B13-2201 და B13-2811 გენომებში გამოვლინდა მათი Illumina წაკითხულის ხელახალი რუქათ B13 საცნობარო გენომზე SAMtools-ის გამოყენებით (Li და სხვ., 2009) და ვიზუალურად დამოწმებული IGV (რობინსონი) გამოყენებით და სხვ., 2011). დიდი INDEL აღმოაჩინა MAUVE (ძვირფასო და სხვ., 2010) აწყობილი მუტანტის წაკითხვის კონტიგების გამოყენებით.

PCR ანალიზი

B13 გენომში USR1 რეგიონის არასტაბილურობის გასაანალიზებლად, B13 კულტივირებული იყო MM-ში 5 მმ 3-CBA-ით, როგორც ნახშირბადის და ენერგიის ერთადერთი წყარო 35 თაობისთვის. დაახლოებით 7, 14, 21, 28 და 35 თაობის შემდეგ, უჯრედები ამოიღეს კულტივიდან, მათი დნმ გამოიცა და გამოიყენეს შაბლონებად PCR-ში. USR1-ის 1,6 კბ მარცხენა საზღვარი (PKB_2522-სა და PKB_2524-ს შორის) და 1,5 კბ-იანი შეერთება PKB_2522-სა და PKB_2737-ს შორის, რომელიც წარმოიქმნება USR1-ის დაკარგვით, გაძლიერდა ორი პრაიმერის ნაკრების გამოყენებით PKB2522.d (TCCTCATTCBGTAG2+2CCTTCGTATCGTC+2CCTTCGTAGTC+2CCCTTCBGCT). .d პლუს PKB2737.u (GTTCAAGCGCGCCTGAAATC) შესაბამისად.


B ვიტამინები

B ვიტამინები არის წყალში ხსნადი ვიტამინების კლასი, რომლებიც მნიშვნელოვან როლს ასრულებენ უჯრედულ მეტაბოლიზმსა და სისხლის წითელი უჯრედების სინთეზში. [1] თუმცა ამ ვიტამინებს მსგავსი სახელები აქვთ (B1, ბ2, ბ3და ა.შ.), ისინი ქიმიურად განსხვავებული ნაერთებია, რომლებიც ხშირად თანაარსებობენ ერთსა და იმავე საკვებში. [1] ზოგადად, დიეტური დანამატები, რომლებიც შეიცავს რვავეს, მოიხსენიება როგორც a B ვიტამინის კომპლექსი. B ვიტამინის ცალკეულ დანამატებს მოიხსენიებენ თითოეული ვიტამინის კონკრეტული ნომრით ან სახელით, როგორიცაა B1 თიამისთვის, B2 რიბოფლავინისთვის და B3 ნიაცინისთვის, მაგალითად. [1] ზოგიერთს უფრო ხშირად ცნობენ სახელით, ვიდრე რიცხვით: ნიაცინი, პანტოტენინის მჟავა, ბიოტინი და ფოლიატი.

თითოეული B ვიტამინი არის კოფაქტორი (ზოგადად კოენზიმი) ძირითადი მეტაბოლური პროცესებისთვის, ან არის წინამორბედი, რომელიც საჭიროა მისი წარმოებისთვის.

B ვიტამინების სია
ვიტამინი სახელი აღწერა
ვიტამინი B1 თიამინი კოენზიმი შაქრისა და ამინომჟავების კატაბოლიზმში.
ვიტამინი B2 რიბოფლავინი კოენზიმების წინამორბედი სახელწოდებით FAD და FMN, რომლებიც საჭიროა ფლავოპროტეინის ფერმენტული რეაქციებისთვის, მათ შორის სხვა ვიტამინების გააქტიურებისთვის.
ვიტამინი B3 ნიაცინი (ნიკოტინის მჟავა) კოენზიმების წინამორბედი, სახელწოდებით NAD და NADP, რომლებიც საჭიროა მრავალი მეტაბოლური პროცესისთვის.
ნიკოტინამიდი
ნიკოტინამიდის რიბოზიდი
ვიტამინი B5 Პანტოთენური მჟავა კოენზიმ A-ს წინამორბედია და ამიტომ საჭიროა მრავალი მოლეკულის მეტაბოლიზმი.
ვიტამინი B6 პირიდოქსინი კოენზიმი მეტაბოლიზმის ბევრ ფერმენტულ რეაქციაში.
პირიდოქსალი
პირიდოქსამინი
ვიტამინი B7 ბიოტინი კოენზიმი კარბოქსილაზას ფერმენტებისთვის, რომელიც საჭიროა ცხიმოვანი მჟავების სინთეზისთვის და გლუკონეოგენეზისთვის.
ვიტამინი B9 ფოლატი წინამორბედი საჭირო იყო დნმ-ის კოფაქტორის შესაქმნელად, აღდგენისა და მეთილირებისთვის სხვადასხვა რეაქციებში, განსაკუთრებით მნიშვნელოვანი უჯრედების სწრაფი გაყოფისა და ზრდისთვის, როგორიცაა ჩვილობისა და ორსულობის დროს.
ვიტამინი B12 კობალამინები ხშირად ციანოკობალამინი ან მეთილკობალამინი ვიტამინის დანამატებში. კოენზიმი, რომელიც მონაწილეობს ადამიანის სხეულის ყველა უჯრედის მეტაბოლიზმში, განსაკუთრებით გავლენას ახდენს დნმ-ის სინთეზსა და რეგულაციაზე, ასევე ცხიმოვანი მჟავების მეტაბოლიზმზე და ამინომჟავების მეტაბოლიზმზე.

Შენიშვნა: სხვა ნივთიერებები, რომლებიც ოდესღაც ვიტამინებად ითვლებოდნენ, მიენიჭათ B-ვიტამინების ნუმერაციის სქემაში, მაგრამ შემდგომში აღმოჩნდა, რომ ისინი ან არ იყვნენ აუცილებელი სიცოცხლისთვის, ან წარმოებული იყო სხეულის მიერ, რითაც არ აკმაყოფილებდა ვიტამინის ორ აუცილებელ კვალიფიკაციას. იხილეთ ნაწილი # დაკავშირებული ნაერთები 4, 8, 10, 11 და სხვა ნომრებისთვის.

B ვიტამინები ყველაზე დიდი რაოდენობით გვხვდება ხორცში, კვერცხსა და რძის პროდუქტებში. [1] გადამუშავებულ ნახშირწყლებს, როგორიცაა შაქარი და თეთრი ფქვილი, უფრო დაბალი B ვიტამინი აქვთ, ვიდრე მათ დაუმუშავებელ კოლეგებს. ამ მიზეზით, ბევრ ქვეყანაში (მათ შორის შეერთებულ შტატებში) კანონით არის მოთხოვნილი, რომ B ვიტამინები თიამინი, რიბოფლავინი, ნიაცინი და ფოლიუმის მჟავა დაემატოს თეთრ ფქვილს გადამუშავების შემდეგ. ეს არის მოხსენიებული, როგორც "გამდიდრებული ფქვილი" საკვების ეტიკეტზე. B ვიტამინები განსაკუთრებით კონცენტრირებულია ხორცში, როგორიცაა ინდაური, ტუნა და ღვიძლი. [2]

B ჯგუფის ვიტამინების წყაროები ასევე შეიცავს პარკოსნებს (ბობოსნები ან ლობიო), მთლიანი მარცვლეული, კარტოფილი, ბანანი, ჩილის წიწაკა, ტემპე, კვების საფუარი, ლუდის საფუარი და მელასა. მიუხედავად იმისა, რომ ლუდის დასამზადებლად გამოყენებული საფუარი იწვევს ლუდს B ვიტამინების წყაროს, [3] მათი ბიოშეღწევადობა მერყეობს ცუდიდან უარყოფითამდე, რადგან ეთანოლის დალევა აფერხებს თიამინის შეწოვას (B).1), [4] [5] რიბოფლავინი (ბ2), [6] ნიაცინი (ბ3), [7] ბიოტინი (B7), [8] და ფოლიუმის მჟავა (B9). [9] [10] გარდა ამისა, ყოველი წინა კვლევა კიდევ უფრო ხაზს უსვამს, რომ ლუდის და სხვა ალკოჰოლური სასმელების მომატებული მოხმარება იწვევს ამ B ვიტამინების წმინდა დეფიციტს და ასეთ დეფიციტთან დაკავშირებულ ჯანმრთელობის რისკებს. [ საჭიროა ციტატა ]

12 ვიტამინი უხვად არ არის ხელმისაწვდომი მცენარეული პროდუქტებისგან, [11] ქმნის B12 დეფიციტი ვეგანების ლეგიტიმური შეშფოთებაა. მცენარეული საკვების მწარმოებლები ზოგჯერ აცხადებენ B12 შინაარსი, რაც იწვევს დაბნეულობას იმის შესახებ, თუ რა წყაროებს იძლევა B12. დაბნეულობა წარმოიქმნება იმის გამო, რომ აშშ-ს ფარმაკოპეის (USP) სტანდარტული მეთოდი B-ის გაზომვისთვის12 შინაარსი არ ზომავს B12 პირდაპირ. ამის ნაცვლად, ის ზომავს ბაქტერიულ რეაქციას საკვებზე. B-ის ქიმიური ვარიანტები12 მცენარეულ წყაროებში ნაპოვნი ვიტამინი აქტიურია ბაქტერიებისთვის, მაგრამ ადამიანის ორგანიზმს არ შეუძლია გამოიყენოს. იგივე ფენომენი შეიძლება გამოიწვიოს B-ის მნიშვნელოვანი გადაჭარბებული მოხსენება12 შემცველობა სხვა სახის საკვებშიც. [12]

B ვიტამინის მოხმარების გაზრდის საერთო გზაა დიეტური დანამატების გამოყენება. B ვიტამინებს ჩვეულებრივ ემატება ენერგეტიკული სასმელები, რომელთაგან ბევრი ბაზარზე დიდი რაოდენობით B ვიტამინებით არის გაყიდული. [13]

იმის გამო, რომ ისინი წყალში ხსნადია, B ვიტამინების ჭარბი რაოდენობა ჩვეულებრივ ადვილად გამოიყოფა, თუმცა ინდივიდუალური შეწოვა, გამოყენება და მეტაბოლიზმი შეიძლება განსხვავდებოდეს. [13] ხანდაზმულებს და სპორტსმენებს შეიძლება დასჭირდეთ B-ის მიღება12 და სხვა B ვიტამინები შეწოვის პრობლემებისა და ენერგიის გამომუშავების გაზრდილი საჭიროების გამო. [ საჭიროა სამედიცინო ციტატა ] მძიმე დეფიციტის შემთხვევაში, B ვიტამინები, განსაკუთრებით B12, ასევე შეიძლება მიწოდებული იყოს ინექციით ნაკლოვანებების აღმოსაფხვრელად. [14] [ არასანდო სამედიცინო წყარო? ] ორივე ტიპის 1 და 2 ტიპის დიაბეტით დაავადებულებს ასევე შეიძლება ურჩიონ თიამინის დამატება, პლაზმაში თიამინის დაბალი კონცენტრაციის მაღალი პრევალენტობისა და დიაბეტთან დაკავშირებული თიამინის კლირენსის გაზრდის საფუძველზე. [15] ასევე, ვიტამინი B9 (ფოლიუმის მჟავას) დეფიციტი ემბრიონის ადრეულ განვითარებაში დაკავშირებულია ნერვული მილის დეფექტებთან. ამგვარად, ქალებს, რომლებიც გეგმავენ დაორსულებას, ჩვეულებრივ ურჩევენ გაზარდონ ფოლიუმის მჟავის ყოველდღიური მიღება და/ან მიიღონ დანამატები. [16]


შინაარსი

ჰომეობოქსის გენების არსებობა პირველად აღმოაჩინეს დროზოფილა ჰომეოზურ ტრანსფორმაციაზე პასუხისმგებელი გენის იზოლირებით, სადაც ფეხები იზრდება თავიდან თავიდან მოსალოდნელი ანტენების ნაცვლად. უოლტერ გერინგმა დაადგინა გენი ე.წ ანტენაპედია რამაც გამოიწვია ეს ჰომეოტური ფენოტიპი. [9] ანალიზი ანტენაპედია გამოავლინა, რომ ეს გენი შეიცავდა 180 ბაზის წყვილის თანმიმდევრობას, რომელიც კოდირებდა დნმ-ის შემაკავშირებელ დომენს, რომელსაც უილიამ მაკგინისმა უწოდა "homeobox". [10] არსებობა დამატებით დროზოფილა გენები, რომლებიც შეიცავს ანტენაპედია ჰომობოქსის თანმიმდევრობა დამოუკიდებლად მოხსენებული იქნა ერნსტ ჰეფენის, მაიკლ ლევინის, უილიამ მაკგინისისა და ვალტერ იაკობ გერინგის მიერ შვეიცარიაში ბაზელის უნივერსიტეტიდან და მეთიუ პ. სკოტი და ემი ვეინერი ინდიანას უნივერსიტეტიდან ბლუმინგტონში 1984 წელს. [11] [12] იზოლაცია ედუარდ დე რობერტისისა და უილიამ მაკგინისის ჰომოლოგიურმა გენებმა გამოავლინეს, რომ მრავალი სახეობის გენი შეიცავს ჰომეობოქსს. [13] [14] შემდგომმა ფილოგენეტიკური კვლევები, რომლებიც დეტალურად აღწერს ჰომეობოქსის შემცველ გენებს შორის ევოლუციურ კავშირს, აჩვენა, რომ ეს გენები არის ყველა ორმხრივ ცხოველში.

დამახასიათებელი ჰომეოდომის ცილის ნაკეცი შედგება 60 ამინომჟავის გრძელი დომენისგან, რომელიც შედგება სამი ალფა სპირალისგან. ქვემოთ მოცემულია კონსენსუსის ჰომეოდომი (

სპირალი 2 და სპირალი 3 ქმნიან ე.წ. ჰომეოდომენის N-ტერმინალური ორი სპირალი ანტიპარალელურია და გრძელი C-ტერმინალური სპირალი უხეშად პერპენდიკულარულია პირველი ორით დადგენილი ღერძების მიმართ. ეს არის მესამე სპირალი, რომელიც უშუალოდ ურთიერთქმედებს დნმ-თან მრავალი წყალბადის ბმის და ჰიდროფობიური ურთიერთქმედების გზით, ისევე როგორც არაპირდაპირი ურთიერთქმედების გზით წყლის მოლეკულების მეშვეობით, რომლებიც ხდება კონკრეტულ გვერდით ჯაჭვებსა და დნმ-ის ძირითად ღარში არსებულ ფუძეებს შორის. [7]

ჰომეოდომის პროტეინები გვხვდება ევკარიოტებში. [2] HTH მოტივის საშუალებით, მათ აქვთ შეზღუდული თანმიმდევრობის მსგავსება და სტრუქტურული მსგავსება პროკარიოტული ტრანსკრიფციის ფაქტორებთან, [16] როგორიცაა ლამბდა ფაგის პროტეინები, რომლებიც ცვლის გენების გამოხატვას პროკარიოტებში. HTH მოტივი გვიჩვენებს გარკვეული თანმიმდევრობის მსგავსებას, მაგრამ მსგავს სტრუქტურას დნმ-ის დამაკავშირებელი ცილების ფართო დიაპაზონში (მაგ., cro და რეპრესორული ცილები, ჰომეოდომინის ცილები და ა.შ.). ერთ-ერთი ძირითადი განსხვავება HTH მოტივებს შორის ამ განსხვავებულ პროტეინებში წარმოიქმნება სტერეოქიმიური მოთხოვნილების გამო გლიცინის მიმართ, რომელიც საჭიროა ბეტა-ნახშირბადის სტერული ჩარევის თავიდან ასაცილებლად მთავარ ჯაჭვთან: cro და რეპრესორული ცილებისთვის გლიცინი, როგორც ჩანს, სავალდებულოა. , მაშინ როცა ბევრი ჰომეოტური და დნმ-ის დამაკავშირებელი სხვა ცილებისთვის მოთხოვნილება მოდუნებულია.

თანმიმდევრობის სპეციფიკის რედაქტირება

Homeodomains can bind both specifically and nonspecifically to B-DNA with the C-terminal recognition helix aligning in the DNA's major groove and the unstructured peptide "tail" at the N-terminus aligning in the minor groove. The recognition helix and the inter-helix loops are rich in arginine and lysine residues, which form hydrogen bonds to the DNA backbone. Conserved hydrophobic residues in the center of the recognition helix aid in stabilizing the helix packing. Homeodomain proteins show a preference for the DNA sequence 5'-TAAT-3' sequence-independent binding occurs with significantly lower affinity. The specificity of a single homeodomain protein is usually not enough to recognize specific target gene promoters, making cofactor binding an important mechanism for controlling binding sequence specificity and target gene expression. To achieve higher target specificity, homeodomain proteins form complexes with other transcription factors to recognize the promoter region of a specific target gene.

Homeodomain proteins function as transcription factors due to the DNA binding properties of the conserved HTH motif. Homeodomain proteins are considered to be master control genes, meaning that a single protein can regulate expression of many target genes. Homeodomain proteins direct the formation of the body axes and body structures during early embryonic development. [17] Many homeodomain proteins induce cellular differentiation by initiating the cascades of coregulated genes required to produce individual tissues and organs. Other proteins in the family, such as NANOG are involved in maintaining pluripotency and preventing cell differentiation.

Hox genes and their associated microRNAs are highly conserved developmental master regulators with tight tissue-specific, spatiotemporal control. These genes are known to be dysregulated in several cancers and are often controlled by DNA methylation. [18] [19] The regulation of Hox genes is highly complex and involves reciprocal interactions, mostly inhibitory. Drosophila is known to use the polycomb and trithorax complexes to maintain the expression of Hox genes after the down-regulation of the pair-rule and gap genes that occurs during larval development. Polycomb-group proteins can silence the HOX genes by modulation of chromatin structure. [20]

Mutations to homeobox genes can produce easily visible phenotypic changes in body segment identity, such as the Antennapedia and Bithorax mutant phenotypes in დროზოფილა. Duplication of homeobox genes can produce new body segments, and such duplications are likely to have been important in the evolution of segmented animals.

The homeobox itself may have evolved from a non-DNA-binding transmembrane domain at the C-terminus of the MraY enzyme. This is based on metagenomic data acquired from the transitional archaeon, ლოკიარქეუმი, that is regarded as the prokaryote closest to the ancestor of all eukaryotes. [21] [ არასანდო წყარო? ]

Phylogenetic analysis of homeobox gene sequences and homeodomain protein structures suggests that the last common ancestor of plants, fungi, and animals had at least two homeobox genes. [22] Molecular evidence shows that some limited number of Hox genes have existed in the Cnidaria since before the earliest true Bilatera, making these genes pre-Paleozoic. [23] It is accepted that the three major animal ANTP-class clusters, Hox, ParaHox, and NK (MetaHox), are the result of segmental duplications. A first duplication created MetaHox and ProtoHox, the latter of which later duplicated into Hox and ParaHox. The clusters themselves were created by tandem duplications of a single ANTP-class homeobox gene. [24] Gene duplication followed by neofunctionalization is responsible for the many homeobox genes found in eukaryotes. [25] [26] Comparison of homeobox genes and gene clusters has been used to understand the evolution of genome structure and body morphology throughout metazoans. [27]

Hox genes Edit

Hox genes are the most commonly known subset of homeobox genes. They are essential metazoan genes that determine the identity of embryonic regions along the anterior-posterior axis. [28] The first vertebrate Hox gene was isolated in ქსენოპუსი by Edward De Robertis and colleagues in 1984. [29] The main interest in this set of genes stems from their unique behavior and arrangement in the genome. Hox genes are typically found in an organized cluster. The linear order of Hox genes within a cluster is directly correlated to the order they are expressed in both time and space during development. This phenomenon is called colinearity.

Mutations in these homeotic genes cause displacement of body segments during embryonic development. This is called ectopia. For example, when one gene is lost the segment develops into a more anterior one, while a mutation that leads to a gain of function causes a segment to develop into a more posterior one. Famous examples are ანტენაპედია and bithorax in დროზოფილა, which can cause the development of legs instead of antennae and the development of a duplicated thorax, respectively. [30]

In vertebrates, the four paralog clusters are partially redundant in function, but have also acquired several derived functions. For example, HoxA and HoxD specify segment identity along the limb axis. [31] [32] Specific members of the Hox family have been implicated in vascular remodeling, angiogenesis, and disease by orchestrating changes in matrix degradation, integrins, and components of the ECM. [33] HoxA5 is implicated in atherosclerosis. [34] [35] HoxD3 and HoxB3 are proinvasive, angiogenic genes that upregulate b3 and a5 integrins and Efna1 in ECs, respectively. [36] [37] [38] [39] HoxA3 induces endothelial cell (EC) migration by upregulating MMP14 and uPAR. Conversely, HoxD10 and HoxA5 have the opposite effect of suppressing EC migration and angiogenesis, and stabilizing adherens junctions by upregulating TIMP1/downregulating uPAR and MMP14, and by upregulating Tsp2/downregulating VEGFR2, Efna1, Hif1alpha and COX-2, respectively. [40] [41] HoxA5 also upregulates the tumor suppressor p53 and Akt1 by downregulation of PTEN. [42] Suppression of HoxA5 has been shown to attenuate hemangioma growth. [43] HoxA5 has far-reaching effects on gene expression, causing

300 genes to become upregulated upon its induction in breast cancer cell lines. [43] HoxA5 protein transduction domain overexpression prevents inflammation shown by inhibition of TNFalpha-inducible monocyte binding to HUVECs. [44] [45]

LIM genes Edit

LIM genes (named after the initial letters of the names of three proteins where the characteristic domain was first identified) encode two 60 amino acid cysteine and histidine-rich LIM domains and a homeodomain. The LIM domains function in protein-protein interactions and can bind zinc molecules. LIM domain proteins are found in both the cytosol and the nucleus. They function in cytoskeletal remodeling, at focal adhesion sites, as scaffolds for protein complexes, and as transcription factors. [46]

Pax genes Edit

Most Pax genes contain a homeobox and a paired domain that also binds DNA to increase binding specificity, though some Pax genes have lost all or part of the homeobox sequence. [47] Pax genes function in embryo segmentation, nervous system development, generation of the frontal eye fields, skeletal development, and formation of face structures. Pax 6 is a master regulator of eye development, such that the gene is necessary for development of the optic vesicle and subsequent eye structures. [48]

POU genes Edit

Proteins containing a POU region consist of a homeodomain and a separate, structurally homologous POU domain that contains two helix-turn-helix motifs and also binds DNA. The two domains are linked by a flexible loop that is long enough to stretch around the DNA helix, allowing the two domains to bind on opposite sides of the target DNA, collectively covering an eight-base segment with consensus sequence 5'-ATGCAAAT-3'. The individual domains of POU proteins bind DNA only weakly, but have strong sequence-specific affinity when linked. The POU domain itself has significant structural similarity with repressors expressed in bacteriophages, particularly lambda phage.

As in animals, the plant homeobox genes code for the typical 60 amino acid long DNA-binding homeodomain or in case of the TALE (three amino acid loop extension) homeobox genes for an atypical homeodomain consisting of 63 amino acids. According to their conserved intron–exon structure and to unique codomain architectures they have been grouped into 14 distinct classes: HD-ZIP I to IV, BEL, KNOX, PLINC, WOX, PHD, DDT, NDX, LD, SAWADEE and PINTOX. [25] Conservation of codomains suggests a common eukaryotic ancestry for TALE [49] and non-TALE homeodomain proteins. [50]

The Hox genes in humans are organized in four chromosomal clusters:

სახელი ქრომოსომა გენი
HOXA (or sometimes HOX1) - [email protected] chromosome 7 HOXA1, HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXA10, HOXA11, HOXA13
HOXB - [email protected] chromosome 17 HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13
HOXC - [email protected] chromosome 12 HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXC12, HOXC13
HOXD - [email protected] chromosome 2 HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXD10, HOXD11, HOXD12, HOXD13

ParaHox genes are analogously found in four areas. They include CDX1, CDX2, CDX4 GSX1, GSX2 and PDX1. Other genes considered Hox-like include EVX1, EVX2 GBX1, GBX2 MEOX1, MEOX2 and MNX1. The NK-like (NKL) genes, some of which are considered "MetaHox", are grouped with Hox-like genes into a large ANTP-like group. [51] [52]

Humans have a "distal-less homeobox" family: DLX1, DLX2, DLX3, DLX4, DLX5, and DLX6. Dlx genes are involved in the development of the nervous system and of limbs. [53] They are considered a subset of the NK-like genes. [51]

Human TALE (Three Amino acid Loop Extension) homeobox genes for an "atypical" homeodomain consist of 63 rather than 60 amino acids: IRX1, IRX2, IRX3, IRX4, IRX5, IRX6 MEIS1, MEIS2, MEIS3 MKX PBX1, PBX2, PBX3, PBX4 PKNOX1, PKNOX2 TGIF1, TGIF2, TGIF2LX, TGIF2LY. [51]

In addition, humans have the following homeobox genes and proteins: [51]


Pharmacologically targeting the myristoylation of the scaffold protein FRS2α inhibits FGF/FGFR-mediated oncogenic signaling and tumor progression

Fibroblast growth factor (FGF)/FGF receptor (FGFR) signaling facilitates tumor initiation and progression. Although currently approved inhibitors of FGFR kinase have shown therapeutic benefit in clinical trials, overexpression or mutations of FGFRs eventually confer drug resistance and thereby abrogate the desired activity of kinase inhibitors in many cancer types. In this study, we report that loss of myristoylation of fibroblast growth factor receptor substrate 2 (FRS2α), a scaffold protein essential for FGFR signaling, inhibits FGF/FGFR-mediated oncogenic signaling and FGF10-induced tumorigenesis. Moreover, a previously synthesized myristoyl-CoA analog, B13, which targets the activity of -myristoyltransferases, suppressed FRS2α myristoylation and decreased the phosphorylation with mild alteration of FRS2α localization at the cell membrane. B13 inhibited oncogenic signaling induced by WT FGFRs or their drug-resistant mutants (FGFRs DRM ). B13 alone or in combination with an FGFR inhibitor suppressed FGF-induced WT FGFR- or FGFR DRM -initiated phosphoinositide 3-kinase (PI3K) activity or MAPK signaling, inducing cell cycle arrest and thereby inhibiting cell proliferation and migration in several cancer cell types. Finally, B13 significantly inhibited the growth of xenograft tumors without pathological toxicity to the liver, kidney, or lung in vivo In summary, our study suggests a possible therapeutic approach for inhibiting FGF/FGFR-mediated cancer progression and drug-resistant FGF/FGFR mutants.

საკვანძო სიტყვები: B13 FRS2 cancer drug action fibroblast growth factor (FGF) fibroblast growth factor receptor (FGFR) myristoylation protein acylation.

© 2018 ბიოქიმიისა და მოლეკულური ბიოლოგიის ამერიკული საზოგადოების მიერ, Inc.

ინტერესთა კონფლიქტის განცხადება

ავტორები აცხადებენ, რომ მათ არ აქვთ ინტერესთა კონფლიქტი ამ სტატიის შინაარსთან


B13. Summary - Biology

Search for the best summaries

Have you written loads of study guides or do you write a lot of notes? On Stuvia, you can sell your study work in a jiffy. Upload your document(s), determine your own price and earn money each time you sell your document(s). Just think about it, you can finally kiss that dreary part-time job goodbye!

  • 5
  • 4
  • 3
  • 2
  • 1
  • All languages
  • ჰოლანდიური
  • ინგლისური
  • Deutsch
  • Français
  • Español
  • ტოტ
  • Მინიმალური
  • Maximum

All 2.393 results

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 40 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 35 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 50 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 4 out of 46 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Preview 3 out of 21 pages

Very detailed and concise AQA A Level Biology notes with key exam terminology&period These notes are neatly handwritten and organised with clear diagrams&period Notes have also been written to meet the specification points&period

Sell your knowledge on Stuvia

Hundred thousands of people are searching for your content every day. You can easily upload your summaries to our platform and start earning money from your study notes.

Sign up for free today and start earning while helping others!

BIOLOGY 9700&sol01Paper 1 Multiple Choice For examination from 2022SPECIMEN PAPER

Preview 3 out of 18 pages

BIOLOGY 9700&sol01Paper 1 Multiple Choice For examination from 2022SPECIMEN PAPER

Official A-level Biology OCR 2020 paper 3&period Good for revision for mini exams&excl

  • შეკვრა
  • Exam (elaborations)
  • &bull 29 pages &bull
  • by AlexHackney &bull
  • uploaded 08-05-2021

Preview 3 out of 29 pages

Official A-level Biology OCR 2020 paper 3&period Good for revision for mini exams&excl

2020 AQA AS Biology Paper 1 MARKSCHEME ONLY

Preview 3 out of 28 pages

2020 AQA AS Biology Paper 1 MARKSCHEME ONLY

AQA A level biology notes from an A&ast student &lparI obtained an A&ast in A level biology&period&rpar&NewLine&NewLineNotes covering&colon Synaptic transmission&comma resting potential&comma the pacinian corpuscle&comma saltatory conduction and action potentials&period

  • Წიგნი
  • Class notes
  • &bull 2 pages &bull
  • by maiziehall &bull
  • uploaded 12-10-2020

AQA A level biology notes from an A&ast student &lparI obtained an A&ast in A level biology&period&rpar&NewLine&NewLineNotes covering&colon Synaptic transmission&comma resting potential&comma the pacinian corpuscle&comma saltatory conduction and action potentials&period

Full biological notes including&colon &NewLineNervous system &NewLineNeurotransmitters &NewLineRecreational drugs and the rewards system &NewLineThe brain&comma limbic system and aggression &NewLineRaine et al&period &NewLineEvolutionary approach &NewLineBiological approach &NewLineBrendagn et al&period &NewLinePsychodynamic theory &NewLineCorrelational studies &NewLineBrain scanning techniques &NewLinePractical &NewLineKey question &NewLineIssues and debates

  • Book & Bundle
  • Class notes
  • &bull 39 pages &bull
  • by saisha1602 &bull
  • uploaded 25-05-2021

Preview 4 out of 39 pages

Full biological notes including&colon &NewLineNervous system &NewLineNeurotransmitters &NewLineRecreational drugs and the rewards system &NewLineThe brain&comma limbic system and aggression &NewLineRaine et al&period &NewLineEvolutionary approach &NewLineBiological approach &NewLineBrendagn et al&period &NewLinePsychodynamic theory &NewLineCorrelational studies &NewLineBrain scanning techniques &NewLinePractical &NewLineKey question &NewLineIssues and debates