ინფორმაცია

დაფარვის განსხვავება ამპლიკონებს შორის

დაფარვის განსხვავება ამპლიკონებს შორის



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

მე მაქვს 2 fastq ფაილი და შევქმენი BAM ფაილი (ინდექსირებული და დალაგებული) ზოგიერთი წაკითხვისგან. მე გავასწორე ისინი საცნობარო გენომთან (hg19).

ვმუშაობ სხვადასხვა პრაიმერებით.

FORWARD 1. TTGCCAGTTAACGTCTTCCTTCTCTCTCTG 2. CCCTTGTCTCTGTGTTCTTGTCCCCCCCA 3. TGATCTGTCCCTCACAGCAGGGTCTTCTCT 4. CACACTGACGTGCCTCTCCCTCCCTCCA რევერსი 1. GAGAAAAGGTGGGCCTGAGGTTCAGAGCCA 2. CCCCACCAGACCATGAGAGGCCCTGCGGCC 3. TGACCTAAAGCCACCTCCTTA 4. CCGTATCTCCCTTCCCTGATTA

ამიტომ მაქვს სხვადასხვა ამპლიკონები. როგორ შემიძლია დავხატო ამ სხვადასხვა ამპლიკონების დაფარვა. და რით შეიძლება აიხსნას დიდი განსხვავება მათ შორის?

დიდი მადლობა დახმარებისთვის.


კარგად, გაშუქების დასაგეგმად გამოვიყენებდი Python Matplotlib-ს მსგავსს. შეხედეთ ამ მაგალითს:

იმპორტი matplotlib.pyplot როგორც PLT იმპორტი matplotlib amplicons = ( "TTGCCAGTTAACGTCTTCCTTCTCTCTCTG", "CCCTTGTCTCTGTGTTCTTGTCCCCCCCA", "TGATCTGTCCCTCACAGCAGGGTCTTCTCT", "CACACTGACGTGCCTCTCCCTCCCTCCA) countAmpl = (1635, 4734, 2156, 3085), ლეღვის = plt.figure (figsize = (10,8.5 )) subplt = fig.add_subplot(111) subplt.set_ylabel('Count') subplt.set_xlabel('Amplicons') subplt.plot(amplicons, countAmpl, linestyle="-", marker="o", color="blue ") tl-ისთვის subplt.get_yticklabels(): tl.set_color('ლურჯი') plt.savefig("amplicons.eps")

შეამოწმეთ სხვა ტიპის დიაგრამები Matplotlib-ში, თუ ფიქრობთ, რომ სხვა რამე გჭირდებათ.

თქვენ ასევე შეგიძლიათ სცადოთ BAM-ის გახსნა და ვიზუალიზაცია IGV-ში Broad Institute-დან.

რაც შეეხება გაშუქების განსხვავებას, მე ვიტყოდი, რომ ზოგიერთი განმეორებადი რეგიონიდან არის. ან რეგიონის გაძლიერების სიღრმე უფრო დიდია, ვიდრე სხვებისთვის. ან იქნებ გასწორებამ იპოვა მსგავსი რეგიონები და გადაწყვიტა, რომ ამპლიკონი კარგად ემთხვევა ყველა ამ რეგიონს.


BEDTools, სხვა პროგრამულ კომპლექტებს შორის, მოგცემთ დაფარვის ჰისტოგრამას. PCR ეფექტურობის მიკერძოების ყველაზე დიდი წყარო მხოლოდ ის არის, რომ ზოგიერთი პრაიმერი უკეთესად მუშაობს, ვიდრე სხვები, ასევე არსებობს თანმიმდევრობის მიკერძოება ბიბლიოთეკის მომზადების PCR გაძლიერების ეტაპზე. ამაში ხელს უწყობს GC შინაარსი.


მიზნობრივი თანმიმდევრობის მიდგომები NGS-ისთვის

მიუხედავად იმისა, რომ ადამიანის გენომის მთლიანი თანმიმდევრობა აქვს მოწინავე აღმოჩენას და ადამიანის ჯანმრთელობას, გენომის რთული რეგიონების ანალიზი რთულია ამ მიდგომის გამოყენებით, რაც იწვევს პოპულაციის თანმიმდევრობის მიკერძოებას და არსებული მონაცემთა ბაზები არ არის არც სრული და არც ზუსტი (1). მრავალი კვლევის აპლიკაციისთვის, მთლიანი გენომის თანმიმდევრობის ღირებულება კვლავ შეიძლება იყოს ტვირთი, განსაკუთრებით მაშინ, როდესაც მხედველობაში მიიღებთ გამოთვლითი დამუშავების და ინფორმატიკის საჭიროებებს მთელი გენომის ანალიზისთვის. ეს დამატებული ღირებულება და სირთულე მცირე სარგებელს მოუტანს დაავადების და მთარგმნელობითი კვლევის აპლიკაციებისთვის საინტერესო კონკრეტული რეგიონის შესწავლისას. ამ საკითხის გადასაჭრელად, ბევრმა მკვლევარმა მიიღო მიზნობრივი თანმიმდევრობის მიდგომა დაფარვის გასაუმჯობესებლად, ანალიზისა და ინტერპრეტაციის გასამარტივებლად და მათი ჯამური თანმიმდევრობის სამუშაო ნაკადის ხარჯების შესამცირებლად.


პირველი, გენომის ან დნმ-ის ნიმუშის სამიზნე რეგიონები გაძლიერებულია კარგად შემუშავებული მულტიპლექსური PCR პრაიმერებით, გადახურული კუდებით, არის ნაწილობრივი ადაპტერული თანმიმდევრობები, რომლებიც თავსებადია შესაბამის დნმ-ის სეკვენსერებთან, რის შედეგადაც მიიღება როგორც სამიზნე ამპლიკონები, ასევე არასპეციფიკური PCR პროდუქტები, მათ შორის პრაიმერის დიმერები.

ტრადიციულად, როდესაც პანელის ზომა დიდია (მაგ. 2000-ზე მეტი ამპლიკონი ერთ აუზში), არასპეციფიკური PCR პროდუქტები შეიძლება იყოს აბსოლუტური და მნიშვნელოვნად იმოქმედოს ქვედა დინების საფეხურებზე, თუ არ არსებობს ზომები მათი ამოღების მიზნით. ამპლიკონზე დაფუძნებული ზოგიერთი მეთოდი იყენებს მძივების გაწმენდას და ზომის შერჩევას დნმ-ის უფრო მცირე ფრაგმენტების მოსაშორებლად, როგორიცაა პრაიმერის დიმერები. თუმცა, ზოგიერთი რთული არასპეციფიკური PCR პროდუქტი, რომლის ზომები მსგავსია სამიზნე ამპლიკონების სიგრძისა და მისი შედეგად მიღებული ბიბლიოთეკებით, შეიძლება რთული იყოს ამოღება მხოლოდ ზომის შერჩევის გამოყენებით. შემდეგი ბიოანალიზატორის კვალი აჩვენებს მნიშვნელოვან ფონურ ხმაურს სამიზნე ბიბლიოთეკის გარშემო 300bp.

/>CleanPlex ბიბლიოთეკის კვალი ფონის გაწმენდის გარეშე

CleanPlex ამ ნაკლოვანებას გადალახავს ინოვაციური და დაპატენტებული ფერმენტული/ქიმიური ფონის გაწმენდის საფეხურით, რომელიც შლის არასპეციფიკურ PCR პროდუქტებს, როგორც პრაიმერის დიმერებს, ასევე უფრო რთულ და ხანგრძლივ არასპეციფიკურ PCR არტეფაქტებს, რაც იწვევს ძალიან სუფთა სამიზნე ბიბლიოთეკებს. შემდეგი ბიოანალიზატორის კვალი აჩვენებს CleanPlex ფონის გაწმენდის ტექნოლოგიის ეფექტს.

/>CleanPlex ბიბლიოთეკის კვალი ფონის გაწმენდით

შემდგომში, შტრიხკოდების ნიმუში (ნიმუშების გაერთიანების მიზნით) ემატება ინდექსირების PCR ნაბიჯით, რათა მიიღოთ თანმიმდევრობისთვის მზად ბიბლიოთეკები. მთელ სამუშაო პროცესს მხოლოდ 3 საათი სჭირდება და მინიმალური პრაქტიკული დრო.


Precision ID Ancestry პანელის შეფასება

ზუსტი დნმ-ზე დაფუძნებული სასამართლო დაზვერვის მიწოდების შესაძლებლობა მოითხოვს დნმ-ის მრავალი მარკერის ანალიზს ბიოლოგიური მტკიცებულებების დონორის ბიოგეოგრაფიული წინაპრების (BGA) და გარედან ხილული მახასიათებლების (EVCs) პროგნოზირებისთვის. მასიურად პარალელური თანმიმდევრობა (MPS) იძლევა ასობით დნმ-ის მარკერის ანალიზს მრავალ ნიმუშში ერთდროულად, რაც ზრდის სასამართლო გამომძიებლებისთვის მიწოდებული ინტელექტის ღირებულებას და ამცირებს მრავალჯერადი ანალიზის შედეგად მიღებული მტკიცებულების მასალის ამოწურვას. Precision ID Ancestry Panel (ყოფილი HID Ion AmpliSeq™ Ancestry Panel) (Thermo Fisher Scientific) (TFS)) შედგება 165 აუტოსომური SNP-ისგან, რომლებიც შერჩეულია BGA-ს დასკვნით. სასამართლო ვალიდაციის კრიტერიუმები გამოყენებული იქნა 95 ნიმუშზე ამ პანელის გამოყენებით, რათა შეფასდეს მგრძნობელობა (1 ნგ-15 პგ), განმეორებადობა (ცვალებადობა და ინსტრუქციების შიგნით) და კომპრომეტირებული და სასამართლო საქმისწარმოების ტიპის ნიმუშების ეფექტები (ხელოვნურად დეგრადირებული და ინჰიბირებული, შერეული წყარო და დაძველებული სისხლისა და ძვლის ნიმუშები). BGA პროგნოზის სიზუსტე შეფასდა ნიმუშების გამოყენებით იმ პირებისგან, რომლებიც თავად აცხადებდნენ თავიანთ წარმომავლობას, როგორც წარმოშობის ცალკეული პოპულაციებიდან ( = 36) ან წარმოშობის მრავალი პოპულაციიდან (n = 14). თანმიმდევრობა ჩატარდა Ion 318™ ჩიპებზე (TFS) Ion PGM™ სისტემაზე (TFS). HID SNP Genotyper v4.3.1 პროგრამული უზრუნველყოფა (TFS) გამოყენებული იყო BGA პროგნოზების შესასრულებლად, შერევის პროპორციების (კონტინენტური დონე) და ალბათობის შეფასების (ქვეპოპულაციის დონე) საფუძველზე. BGA პროგნოზი ზუსტი იყო დნმ-ის შაბლონის რაოდენობით 125 pg და 30 pg, შესაბამისად 21 და 25 PCR ციკლების გამოყენებით. HID SNP გენოტიპერის კონტინენტური დონის BGA დავალებები შეესაბამებოდა BGA-ებს თვითგამოცხადებული აღმოსავლეთ აზიის, აფრიკის, ევროპის და სამხრეთ აზიის ქვეყნებისთვის. კომპრომეტირებული, შერეული წყარო და შერეული ნიმუშები, გარდა ქვეპოპულაციის დონის პროგნოზისა, მოითხოვს უფრო ვრცელ ანალიზს.

ეს არის გამოწერის შინაარსის გადახედვა, წვდომა თქვენი დაწესებულების მეშვეობით.


Აბსტრაქტული

სასამართლო ფენოტიპს შეუძლია უზრუნველყოს სასარგებლო დაზვერვა მტკიცებულებათა ნიმუშის დონორის ბიოგეოგრაფიული წინაპრების (BGA) და გარედან ხილული მახასიათებლების (EVCs) შესახებ. ამჟამად, BGA და EVC-ების ერთ ნუკლეოტიდის პოლიმორფიზმის (SNP) დაფუძნებული დასკვნა ყველაზე ხშირად ხორციელდება SNaPshot ®, ერთი ბაზის გაფართოების (SBE) ანალიზის გამოყენებით. თუმცა, ერთი SNaPshot მულტიპლექსური PCR შემოიფარგლება 30-40 SNP-ით. შემდეგი თაობის თანმიმდევრობა (NGS) გთავაზობთ ასობით ან ათასობით SNP-ის გენოტიპის პოტენციალს მრავალი ნიმუშიდან ერთ ექსპერიმენტულ პერსპექტივაში. PCR მულტიპლექსები ხუთ SNaPshot ანალიზიდან (SNPამისთვისID 52plex, SNPამისთვისID 34plex, Eurasiaplex, IrisPlex და გამოუქვეყნებელი BGA ანალიზი) გამოყენებული იყო დნმ-ის შაბლონის სამ სხვადასხვა რაოდენობაზე (0.1, 0.2 და 0.3 ნგ) სამ ნიმუშში (9947A და 007 საკონტროლო დნმ და მამაკაცი დონორი). გაერთიანებული PCR ამპლიკონები, რომლებიც შეიცავდა 136 უნიკალურ SNP-ს, დახარისხდა Life Technologies-ის Ion Torrent™ PGM სისტემის გამოყენებით. დაახლოებით 72 Mb თანმიმდევრობა შეიქმნა ორი 10 Mb Ion 314™ v1 ჩიპიდან. ზუსტი გენოტიპები ადვილად იქნა მიღებული სამივე შაბლონის რაოდენობით. სულ 408 გენოტიპიდან 395 (97%) სრულად შეესაბამება SNaPshot-ს სამივე შაბლონის რაოდენობაში. იმ გენოტიპებიდან, რომლებიც არ შეესაბამება SNaPshot-ს, ექვსი იონური ტორენტის თანმიმდევრობა (1.5%) სრულად შეესაბამება Sanger-ის თანმიმდევრობას სამი შაბლონის რაოდენობაში. შვიდი SNP (1.7%) იყო ან შეუსაბამოდ შაბლონის რაოდენობას შორის ან შეუსაბამოდა Sanger-ის თანმიმდევრობას. ნეგატიურ კონტროლში დაფიქსირებული თანმიმდევრობის დაფარვა და ჰეტეროზიგოტური გენოტიპებისთვის ალელის დაფარვის ცვალებადობა ხაზს უსვამს მიმდევრობის გამომუშავების ფონური დონისა და ჰეტეროზიგოტური ბალანსის ზღვრის დადგენის აუცილებლობას. იონური ტორენტის PGM სისტემის ამ წინასწარმა კვლევამ აჩვენა სასამართლო დნმ-ის ანალიზებში გამოყენების მნიშვნელოვანი პოტენციალი, როგორც დაბალი და საშუალო გამტარუნარიანობის NGS პლატფორმა დადგენილი SNaPshot ანალიზის გამოყენებით.


Q5® მაღალი სიზუსტის დნმ პოლიმერაზები

Q5 ® High-Fidelity დნმ პოლიმერაზა (NEB #M0491) ადგენს ახალ სტანდარტს როგორც ერთგულებისთვის, ასევე მტკიცე მუშაობისთვის. ხელმისაწვდომი უმაღლესი ერთგულების გაძლიერებით (>280-ჯერ მეტი ვიდრე ტაქ), Q5 დნმ პოლიმერაზა იწვევს ულტრა დაბალ შეცდომის სიხშირეს. Q5 დნმ პოლიმერაზა შედგება ახალი პოლიმერაზასგან, რომელიც შერწყმულია პროცესურობის გამაძლიერებელ Sso7d დნმ-ის დამაკავშირებელ დომენთან, რაც აუმჯობესებს მუშაობის სიჩქარეს, ერთგულებას და საიმედოობას. Q5 მასტერ მიქსები შეიცავს dNTP-ებს, Mg++ და საკუთრებაში არსებულ ფართო გამოყენების ბუფერს, რომელიც მოითხოვს მხოლოდ პრაიმერების და დნმ-ის შაბლონის დამატებას ძლიერი გაძლიერებისთვის, GC შემცველობის მიუხედავად.

სიახლე: Q5U Hot Start მაღალი სიზუსტის დნმ პოლიმერაზა (NEB #M0515). Q5U არის Q5 მაღალი ერთგულების დნმ პოლიმერაზას მოდიფიცირებული ვერსია, რომელიც შეიცავს მუტაციას ურაცილის დამაკავშირებელ ჯიბეში, რომელიც იძლევა ურაცილისა და ინოზინის ფუძეების შემცველი შაბლონების წაკითხვისა და გაძლიერების შესაძლებლობას. ეს სასარგებლოა ბისულფიტით გარდაქმნილი, ფერმენტულად დეამინირებული ან დაზიანებული დნმ-ის გასაძლიერებლად, PCR-ში (როდესაც გამოიყენება dUTP-თან და UDG-თან ერთად) და USER-ის კლონირების მეთოდებში გადატანილი დაბინძურების თავიდან ასაცილებლად. შეიტყვეთ მეტი ამ პროდუქტის შესახებ.

მაღალი სიზუსტის პოლიმერაზების შედარება

1 ჩვენ ვაგრძელებთ გაუმჯობესებული ანალიზების გამოკვლევას Q5&rsquos ძალიან დაბალი შეცდომის სიხშირის დასახასიათებლად, რათა დავრწმუნდეთ, რომ წარმოგიდგენთ ყველაზე ზუსტი ერთგულების მონაცემებს (Potapov, V. and Ong, J.L. (2017) PLoS ONE. 12(1): e0169774).
2 PCR-ზე დაფუძნებული მუტაციის სკრინინგი lacI-ში (Agilent) ან rpsL-ში (Life).

უპირატესობები

  • უმაღლესი ერთგულების გაძლიერება (>280X უფრო მაღალი ვიდრე ტაქ)
  • ულტრა დაბალი შეცდომის მაჩვენებელი
  • უმაღლესი შესრულება ამპლიკონების ფართო სპექტრისთვის (მაღალი AT-დან მაღალ GC-მდე)
  • ხელმისაწვდომია ცხელი დაწყების და მასტერ მიქსის ფორმატები

Q5 ბუფერული სისტემა შექმნილია იმისთვის, რომ უზრუნველყოს უმაღლესი შესრულება მინიმალური ოპტიმიზაციით ამპლიკონების ფართო სპექტრში, GC შინაარსის მიუხედავად. რუტინული ან რთული ამპლიკონებისთვის მდე

65% GC შემცველობა, Q5 რეაქციის ბუფერი (NEB #B9027) უზრუნველყოფს საიმედო და მტკიცე გაძლიერებას. GC მაღალი შემცველობის ამპლიკონებისთვის (>65% GC), Q5 High GC Enhancer-ის დამატება უზრუნველყოფს მაქსიმალურ შესრულებას. Q5 და Q5 Hot Start დნმ პოლიმერაზები ხელმისაწვდომია როგორც დამოუკიდებელი ფერმენტები, ან ძირითადი მიქსის ფორმატში დამატებითი მოხერხებულობისთვის. მასტერ მიქსის ფორმულირებები მოიცავს dNTPs, Mg ++ და ყველა საჭირო ბუფერულ კომპონენტს.

ძლიერი გაძლიერება Q5 (A) და Q5 ცხელი დაწყება (B) მაღალი სიზუსტის დნმ პოლიმერაზებით

სხვადასხვა ადამიანის გენომის ამპლიკონების გაძლიერება დაბალიდან მაღალ GC შემცველობამდე Q5 ან Q5 Hot Start მაღალი სიზუსტის დნმ პოლიმერაზას გამოყენებით. რეაქციები Q5 Hot Start-ის გამოყენებით დაყენებული იყო ოთახის ტემპერატურაზე. ყველა რეაქცია ჩატარდა გაძლიერების 30 ციკლის გამოყენებით და ვიზუალიზებული იყო მიკროფლუიდური LabChip® ანალიზით.

ქიმიურად მოდიფიცირებული ან ანტისხეულებზე დაფუძნებული ცხელი დაწყების პოლიმერაზებისგან განსხვავებით, NEB-ის Q5 Hot Start (NEB #M0493) იყენებს უნიკალურ სინთეტიკურ აპტამერს. ეს მოლეკულა აკავშირებს პოლიმერაზას არაკოვალენტური ურთიერთქმედების გზით, რაც ბლოკავს აქტივობას რეაქციის დაყენების დროს. პოლიმერაზა აქტიურდება ნორმალური ციკლის პირობებში, რაც საშუალებას აძლევს რეაქციის დაყენებას ოთახის ტემპერატურაზე. Q5 Hot Start არ საჭიროებს ცალკე მაღალი ტემპერატურის აქტივაციის საფეხურს, რეაქციის დროის შემცირებას და გამოყენების სიმარტივის გაზრდას. Q5 Hot Start Polymerase იდეალური არჩევანია მაღალი სპეციფიკის გამაძლიერებლისთვის და უზრუნველყოფს ფართო სპექტრის ამპლიკონების ძლიერ გაძლიერებას, GC შემცველობის მიუხედავად.

გაძლიერების შესრულება გენომიური მიზნების ფართო სპექტრში

PCR ჩატარდა სხვადასხვა ამპლიკონებით, GC შემცველობით მაღალი AT-დან მაღალ GC-მდე, Q5-ით და რამდენიმე სხვა კომერციულად ხელმისაწვდომი პოლიმერაზებით. ყველა პოლიმერაზა ციკლირებული იყო მწარმოებლის რეკომენდაციების შესაბამისად, მათ შორის GC ბუფერების და გამაძლიერებლების გამოყენება, როდესაც რეკომენდებულია. რეაქციის პროდუქტების მოსავლიანობა და სისუფთავე იყო რაოდენობრივი და წარმოდგენილი, როგორც ნაჩვენებია ფიგურის კლავიშზე, წერტილის ფერისა და ზომის მიხედვით. დიდი მუქი მწვანე წერტილი წარმოადგენს ყველაზე წარმატებულ შესრულებას. Q5 უზრუნველყოფს უმაღლესი შესრულებას GC შინაარსის დიაპაზონში.

Master Mix და ცალკე ფორმატები უზრუნველყოფს მოხერხებულობას და მოქნილობას

Q5 ® არის New England Biolabs, Inc-ის რეგისტრირებული სავაჭრო ნიშანი.
LabChip ® არის Caliper Life Sciences-ის რეგისტრირებული სავაჭრო ნიშანი, Perkin Elmer, Inc-ის ნაწილი.

აირჩიეთ ტიპი:

  • ხშირად დასმული კითხვები
  • პროტოკოლები
  • განაცხადის შენიშვნები
  • ინსტრუმენტები და რესურსები
  • პუბლიკაციები
  • PCR შერჩევის ინსტრუმენტი
  • მაღალი სიზუსტის პოლიმერაზების შედარება
  • Q5 დნმ პოლიმერაზა გთავაზობთ უმაღლეს გაძლიერებას შაბლონების ფართო სპექტრისთვის
  • Q5-ის ხუთი ხარისხის მახასიათებელი
  • დნმ პოლიმერაზას შერჩევის სქემა
  • Ლეგალური ინფორმაცია

მხატვრული სტატიები

წაიკითხეთ ურთიერთობა პოლიმერაზას სტრუქტურასა და ფუნქციას შორის დნმ-ის კოპირებისას.

ბროშურები

შერჩევის ინსტრუმენტები

პრობლემების მოგვარების სახელმძღვანელო

გამოყენების ინსტრუქციები

  1. ერთგულება &აშლიეთ ხელმისაწვდომი უმაღლესი ერთგულების გაძლიერება (>100X უფრო მაღალი ვიდრე ტაქ)
  2. გამძლეობა მაღალი სპეციფიკა და პროდუქტიულობა მინიმალური ოპტიმიზაციით
  3. გაშუქება და აქვს უმაღლესი შესრულება ამპლიკონების ფართო სპექტრისთვის (მაღალი AT-დან მაღალ GC-მდე)
  4. სიჩქარე დაშალე გაფართოების მოკლე დრო
  5. ამპლიკონის სიგრძე &ndash ძლიერი გამაძლიერებლები 20 კბ-მდე მარტივი შაბლონებისთვის და 10 კბ კომპლექსისთვის

NEB გთავაზობთ გაიდლაინებს თქვენი განაცხადისთვის სწორი დნმ პოლიმერაზას არჩევისთვის სპეციფიკური თვისებების ჩამონათვალის მიწოდებით. რამდენიმე ფაქტორი განსაზღვრავს, თუ რომელი პოლიმერაზა უნდა იქნას გამოყენებული მოცემულ აპლიკაციაში, მათ შორის:

შაბლონის/პროდუქტის სპეციფიკა: ჩართულია რნმ ან დნმ? არის 3' ტერმინალი უფსკრულით, ნიკით თუ შაბლონის ბოლოს?

არსებული ნუკლეოტიდების მოცილება: მოიხსნება თუ არა ნუკლეოტიდი(ები) არსებული პოლინუკლეოტიდური ჯაჭვიდან, როგორც პროტოკოლის ნაწილი? თუ ასეა, მოიხსნება ისინი 5' ან 3' ბოლოდან?

თერმული სტაბილურობა: სჭირდება თუ არა პოლიმერაზას გადარჩენა ინკუბაციის დროს მაღალ ტემპერატურაზე თუ სასურველია სითბოს ინაქტივაცია?

ერთგულება: იქნება თუ არა შემდგომი თანმიმდევრობის ანალიზი ან გამოხატვა დამოკიდებული სინთეზირებული პროდუქტების ერთგულებაზე?

ეს პროდუქტი დაფარულია ერთი ან მეტი პატენტით, სავაჭრო ნიშნით და/ან საავტორო უფლებებით, რომლებიც ეკუთვნის ან აკონტროლებს New England Biolabs, Inc (NEB).

მიუხედავად იმისა, რომ NEB ავითარებს და ამოწმებს თავის პროდუქტებს სხვადასხვა აპლიკაციებისთვის, ამ პროდუქტის გამოყენებამ შეიძლება მოითხოვოს მყიდველს გარკვეული აპლიკაციებისთვის მესამე მხარის ინტელექტუალური საკუთრების დამატებითი უფლებების მოპოვება.

კომერციული უფლებების შესახებ დამატებითი ინფორმაციისთვის, გთხოვთ, დაუკავშირდეთ NEB-ის გლობალური ბიზნესის განვითარების გუნდს მისამართზე [email protected]

ეს პროდუქტი განკუთვნილია მხოლოდ კვლევის მიზნებისთვის. ეს პროდუქტი არ არის განკუთვნილი ადამიანებში ან ცხოველებში თერაპიული ან დიაგნოსტიკური მიზნებისათვის გამოსაყენებლად.


რა არის დაგეგმილი

- დაამატებს ქუქიების მხარდაჭერას, რათა დაიმახსოვროთ ინდივიდუალურად მინიჭებული შეყვანის პარამეტრები ერთი სესიიდან მეორეზე. თუ იყენებთ პარამეტრების სტანდარტულ კომპლექტს, აღარ დაგჭირდებათ მათი ხელახლა შეყვანა muPlex სერვერის ყოველი მონახულებისას. ქუქიების გამოყენება სრულიად არჩევითი იქნება. თუ თქვენს ბრაუზერში ქუქი-ფაილები გამორთულია, ინტერფეისი ჩუმად დაუბრუნდება ნაგულისხმევ პარამეტრებს.

- შემოგთავაზებთ muPlex ფორუმს (ვიკი?) ჩვენი მომხმარებელთა გაფართოებული სიის მხარდაჭერისთვის!

- გაქვთ იდეები muPlex-ის გასაუმჯობესებლად? ჩვენი მუდმივი განვითარების მცდელობები უპირველეს ყოვლისა ეხმიანება ჩვენი მომხმარებლების წინადადებებს. (იხ კითხვები და გამოხმაურება ქვევით.)


კამათი HPV ვაქცინის შესახებ

2011 წელს რესპუბლიკელ საპრეზიდენტო კანდიდატებს შორის დებატების დროს, ერთ-ერთმა კანდიდატმა მიქელე ბახმანმა მიანიშნა, რომ HPV-ის ვაქცინა უსაფრთხოა ბავშვებისთვის და შეიძლება გამოიწვიოს გონებრივი ჩამორჩენილობა. მეცნიერებმა და სხვა ჯანდაცვის პროფესიონალებმა მაშინვე წარმოადგინეს მტკიცებულება, რომ უარყოთ ეს განცხადება. ა USA Today სტატიაში, „არ არსებობს მტკიცებულება, რომ HPV ვაქცინები საშიშია“ (2011 წლის 19 სექტემბერი), აღწერილია დაავადებათა კონტროლისა და პრევენციის ცენტრის (CDC) ორი კვლევა, რომელიც აკონტროლებს ვაქცინის უსაფრთხოებას. გთავაზობთ ამონარიდს სტატიიდან:

  • პირველი, CDC მონიტორინგს უწევს ანგარიშებს ვაქცინის არასასურველი მოვლენის მოხსენების სისტემაში, მონაცემთა ბაზაში, სადაც ნებისმიერს შეუძლია შეატყობინოს საეჭვო გვერდითი ეფექტის შესახებ. შემდეგ CDC-ის ოფიციალური პირები იკვლევენ, რათა დაინახონ, შეიძლება თუ არა დაფიქსირებული პრობლემები გამოწვეული იყოს ვაქცინებით თუ უბრალოდ დამთხვევაა. მეორეც, CDC თვალყურს ადევნებდა გოგონებს, რომლებიც იღებენ ვაქცინას დროთა განმავლობაში, ადარებდა მათ არავაქცინირებული გოგონების საკონტროლო ჯგუფს…. კვლავ აღმოჩნდა, რომ HPV ვაქცინა უსაფრთხოა.

ელიზაბეტ როზენტალის სტატიის თანახმად, „ნარკოტიკების მწარმოებლების ზეწოლა იწვევს კიბოს ვაქცინების ზრდას“ (New York Times, 2008 წლის 19 აგვისტო), FDA-მ და CDC-მ განაცხადეს, რომ „მილიონობით ვაქცინაციით, მხოლოდ შემთხვევით, სერიოზული გვერდითი ეფექტები და სიკვდილი მოხდება ვაქცინაციის შემდგომ პერიოდში, მაგრამ არაფერი აქვს საერთო ვაქცინასთან“. სტატიაში ნათქვამია, რომ FDA და CDC აკონტროლებენ მონაცემებს იმის დასადგენად, არის თუ არა უფრო სერიოზული შედეგები, ვიდრე მოსალოდნელია მხოლოდ შემთხვევით.

სხვა წყაროს მიხედვით, CDC-ის მონაცემები ვარაუდობს, რომ ვაქცინაციის შემდეგ ჯანმრთელობის სერიოზული პრობლემები 100 000-დან დაახლოებით 3-ს შეადგენს. ეს არის 0.00003 პროპორცია. მაგრამ არის თუ არა ეს ჯანმრთელობის პრობლემები ვაქცინის გამო? არის თუ არა მსგავსი ჯანმრთელობის პრობლემების მაჩვენებელი მათთვის, ვინც ვაქცინას არ იღებს? დავუშვათ, რომ არ არსებობს განსხვავებები ჯანმრთელობის სერიოზული პრობლემების მაჩვენებელში სამკურნალო და საკონტროლო ჯგუფებს შორის. ანუ, დავუშვათ, რომ ჯანმრთელობის სერიოზული პრობლემების პროპორცია ორივე ჯგუფში არის 0.00003.

დავუშვათ, CDC მიჰყვება 100,000 გოგონას შემთხვევით ნიმუშს, რომლებსაც ჰქონდათ ვაქცინა და 200,000 გოგონების შემთხვევით ნიმუშს, რომლებსაც არ ჰქონდათ ვაქცინა. დროთა განმავლობაში ისინი ითვლიან პროპორციას თითოეულ ჯგუფში, რომელსაც აქვს ჯანმრთელობის სერიოზული პრობლემები.

Კითხვა: რამდენი განსხვავებაა ამ ნიმუშის პროპორციებში უჩვეულო, თუ ვაქცინა არ ახდენს გავლენას ჯანმრთელობის სერიოზული პრობლემების წარმოქმნაზე?

ამ კითხვაზე პასუხის გასაცემად, ჩვენ უნდა დავინახოთ, რამდენ ვარიაციას შეიძლება ველოდოთ შემთხვევით ნიმუშებში, თუ არ არის სხვაობა სერიოზული ჯანმრთელობის პრობლემების წარმოქმნის სიხშირეში, ამიტომ ვიყენებთ განსხვავებების შერჩევის განაწილებას ნიმუშის პროპორციებში.

  • გავრცელება: დიდი ნიმუშები წარმოქმნის სტანდარტულ შეცდომას, რომელიც ძალიან მცირეა. ნიმუშის პროპორციებში განსხვავებების სტანდარტული შეცდომაა

პასუხი: ჩვენ შეგვიძლია შევხედოთ შემთხვევითი ნიმუშები, რომლებიც განსხვავდება საშუალოდან 2-ზე მეტი სტანდარტული შეცდომით, როგორც უჩვეულო. თუ ჯანმრთელობის სერიოზული პრობლემების წარმოშობის მაჩვენებელში სხვაობა არ არის, საშუალო არის 0. ასე რომ, 0 + 2(0.00002) = 0.00004-ზე მეტი მაჩვენებლების სხვაობა უჩვეულოა. ეს უდრის ჯანმრთელობის სერიოზული პრობლემების კიდევ 4 შემთხვევას 100 000-ში. ასეთი დიდი ნიმუშებით, ჩვენ ვხედავთ, რომ ვაქცინის ჯგუფში ჯანმრთელობის სერიოზული პრობლემების მცირე რაოდენობა უჩვეულო იქნება. მაგრამ არის თუ არა პრაქტიკული მნიშვნელობის მქონე 4 შემთხვევა 100 000-დან ვაქცინის პოტენციურ სარგებელს? ეს არის მნიშვნელოვანი კითხვა CDC-სთვის.

Სცადე

AFL-CIO-ს მიერ გამოქვეყნებული 2008 წლის კვლევის მიხედვით, პროფკავშირის მუშაკთა 78%-ს ჰქონდა სამუშაოები დამსაქმებლის ჯანმრთელობის დაფარვით, ვიდრე პროფკავშირის მუშაკთა 51%-ს. 2009 წელს, Employee Benefit Research Institute-მა მოიყვანა მონაცემები დიდი ნიმუშებიდან, რომლებიც ვარაუდობდნენ, რომ პროფკავშირის მუშაკთა 80%-ს ჰქონდა ჯანმრთელობის დაცვა, არაპროფკავშირის მუშაკების 56%-თან შედარებით. დავუშვათ, 2009 წლის მონაცემები მოვიდა 3000 პროფკავშირის მუშაკისა და 5000 არაპროფკავშირის მუშაკის შემთხვევითი ნიმუშებიდან.

Სცადე

ქვემოთ მოცემულია ამონარიდი პრესრელიზიდან AFL-CIO ვებსაიტზე, რომელიც გამოქვეყნდა 2003 წლის ოქტომბერში.

  • Wal-Mart ასახავს მავნე ტენდენციას ამერიკის მსხვილ დამსაქმებლებს შორის, რათა თავი აარიდონ ჯანმრთელობის დაზღვევის პასუხისმგებლობებს მათი მუშაკებისა და საზოგადოების ხარჯზე…. შემცირებული დაფარვით და გაზრდილი მუშაკთა პრემიის საფასურით, Wal-Mart – აშშ-ში უმსხვილესი კერძო დამსაქმებელი – ადგენს შემაშფოთებელ სტანდარტს. Wal-Mart-ის მუშაკების ნახევარზე ნაკლები დაზღვეულია კომპანიის გეგმის მიხედვით და მხოლოდ 46 პროცენტი. ეს მაჩვენებელი მკვეთრად დაბალია, ვიდრე მსხვილ კერძო ფირმებში დასაქმებულთა 66 პროცენტი, რომლებიც დაზღვეულია მათი კომპანიების გეგმების მიხედვით, დღეს გამოქვეყნებული თანამეგობრობის ფონდის ახალი კვლევის თანახმად, რომელიც ადასტურებს მზარდ ტენდენციას მსხვილ დამსაქმებლებს შორის, უარი თქვან ჯანმრთელობის დაზღვევაზე მათი მუშაკებისთვის.

დავუშვათ, გვინდა დავინახოთ, ასახავს თუ არა ეს განსხვავება ჩვენს საზოგადოებაში მუშაკთა სადაზღვევო დაფარვას. ჩვენ ვირჩევთ Wal-Mart-ის 50 თანამშრომლისა და 50 თანამშრომლის შემთხვევით ნიმუშს ჩვენი საზოგადოების სხვა მსხვილი კერძო ფირმებიდან. დავუშვათ, რომ Wal-Mart-ის თანამშრომლებიდან 20-ს და სხვა თანამშრომლებს შორის 35-ს აქვს დაზღვევა დამსაქმებლის მეშვეობით.


AmpliSeq Illumina-ს მორგებული და საზოგადოების პანელებისთვის ხშირად დასმული კითხვებისთვის

არა, ახალი ვერსია ამჟამად არ იგეგმება. თაროზე არსებული პანელები და საზოგადოების პანელები დაფუძნებულია hg19-ზე. წინასწარ შემუშავებული პანელების კონვერტაცია შესაძლოა მომავალში განიხილებოდეს ბაზრის მოთხოვნიდან გამომდინარე.

DesignStudio

რა არის სამიზნე ამპლიკონის ზომები?

ამპლიკონს შეიძლება ჰქონდეს დიაპაზონი, სადაც ირჩევთ ამპლიკონის მაქსიმალურ ზომას.

ამპლიკონის ზომები ექვივალენტურია ჩასმის ზომის?

იმის გამო, რომ ჩვენ პრაიმერებს ვამუშავებთ ნაწილობრივი დაშლის ამპლიკონების საფეხურზე, მიღებული ჩანართის ზომები უფრო მცირე იქნება ვიდრე ამპლიკონის ზომა. არჩეული წაკითხვის სიგრძის მიხედვით, ჩვენ გირჩევთ ადაპტერის მორთვას.

რატომ არის რთული დიზაინის ზოგიერთი სამიზნე DesignStudio-ში?
  • ჰომოლოგები: იმავე დიზაინში ჰომოლოგების არსებობამ შეიძლება გამოიწვიოს დაბალი დიზაინის უნარი. დაყავით ჰომოლოგები ცალკეულ აუზებად.
  • GC კონტენტი: 80%-ზე მეტი GC შემცველობის მქონე რეგიონების დაპროექტება რთულია, განსაკუთრებით მაშინ, როდესაც ეს რეგიონები 500 bp-ზე მეტია სიგრძით.
  • ჰომოპოლიმერული თანმიმდევრობები და განმეორებადი ელემენტები: DesignStudio თავს არიდებს ამ რეგიონებს, რათა დარწმუნდეს, რომ ზონდებს აქვთ უკეთესი სპეციფიკა გენომში.
  • ცუდი სპეციფიკა: DesignStudio შეაფასებს ზონდების სპეციფიკას და გამორიცხავს მათ, რომლებიც არ უზრუნველყოფენ დამაკმაყოფილებელ სამიზნე დაფარვას.
როგორ ირჩევს DesignStudio პრაიმერებს?

ოპტიმალური ზონდები არჩეულია ალგორითმის გამოყენებით, რომელიც ითვალისწინებს დნობის ტემპერატურას (Tm), % GC, სიგრძეს, მეორად სტრუქტურას, უნიკალურობას გენომში და ძირეული SNP-ების არსებობას (dbSNP-ზე დაყრდნობით). დამატებითი ინფორმაციისთვის იხილეთ DesignStudio ონლაინ დახმარება.

როგორ გავაუმჯობესო დიზაინისა და დაფარვის შესაძლებლობა ჩემს DesignStudio პროექტში?
  • სამიზნის ზომების გაზრდამ შეიძლება გადაარჩინოს ადრე „დაუგეგმავი“ რეგიონები. სამიზნის გაზრდილი ზომა DesignStudio-ს ცოტა მეტ მოქნილობას ანიჭებს, რათა უფრო მაღალი ქულის ამპლიკონი მოერგოს სასურველ სამიზნე ბაზებს.
  • შეცვალეთ პანელის კონტექსტი – მაგალითად, უაღრესად ჰომოლოგიური ან მაღალი GC მდიდარი სამიზნე თანმიმდევრობის ერთსა და იმავე მულტიპლექსურ დიზაინში მოთავსება შეიძლება იყოს პრობლემური ზონდების დიზაინისთვის თითოეული სამიზნის დისკრეტულად გასაძლიერებლად. პრობლემური რეგიონების ცალკე დიზაინში გადატანა შეიძლება ხშირად გააუმჯობესოს დიზაინის შესაძლებლობა.
  • შეცვალეთ სიმკაცრის დონეები.
შემიძლია შევქმნა ორმაგი აუზის დიზაინი?

არა. ეს არის მულტიპლექსური PCR, რომელიც ვერ გაარჩევს ზედა და ქვედა ძაფს.

შემიძლია თუ არა ჩემი დიზაინის შინაარსის რედაქტირება მისი წარდგენის შემდეგ?

არა. თუმცა, შეგიძლიათ გამოიყენოთ ღილაკი „დიზაინის შეცვლა“ კონტენტის ახალ პანელზე დასაკოპირებლად და შემდეგ მისი რედაქტირებისთვის.

შემიძლია ჩემი დიზაინის რედაქტირება შეკვეთის განთავსების შემდეგ?

არა. შეკვეთის განთავსების შემდეგ, თქვენ ვერ შეძლებთ დიზაინის რედაქტირებას. BaseSpace Sequence Hub-ისა და Local Run Manager-ის მიერ ანალიზისთვის საჭირო ფაილები უნდა დარჩეს თქვენს მიერ შეკვეთილ მასალასთან.

რა არის წარდგენილი დიზაინის მიმდინარე შემობრუნების დრო სამიზნე ზომის ან მიზნების რაოდენობის მიხედვით?

250 კბ-ზე მცირე ზომის დიზაინს აქვს მოსალოდნელი შემობრუნების დრო 48 საათი ან ნაკლები. 250 კბ-ზე მეტი ზომის ან მრავალი სამიზნის მქონე დიზაინს შეიძლება 48 საათზე მეტი დრო დასჭირდეს დაბრუნებას.

მოთხოვნილ დიზაინს აქვს უფრო მოკლე დრო, ვიდრე სხვა წარდგენა. 250 კბ ან ნაკლები მოთხოვნის დიზაინი უნდა დაბრუნდეს 2 საათზე ნაკლებ დროში.

რა განსაზღვრავს ამპლიკონის დიზაინის კრიტერიუმებს?

ამჟამად, DesignStudio მომხმარებლებს საშუალებას აძლევს აირჩიონ ამპლიკონის ზომა 140, 175, 275 ან 375 (რეკომენდებულია MiSeq-ისთვის) თითოეული დიზაინისთვის. ამპლიკონის ზომა მოიცავს პრაიმერის თანმიმდევრობას და ჩანართის რეგიონებს. ჩვენ გირჩევთ გამოიყენოთ 175 bp FFPE დნმ-ისთვის, 140 bp cfDNA-სთვის და 275 bp ნორმალური დნმ-ისთვის.

შესაძლებელია თუ არა AmpliSeq-ის გამოყენება Illumina-ს დიზაინისთვის მრავალი SNP-ის (1000-მდე ან მეტი) ეკრანიზაციისთვის მრავალი ინდივიდისთვის (1000-მდე ან მეტი)?

დიახ, DesignStudio საშუალებას აძლევს SNP გენოტიპირებას თანმიმდევრობით.

რა არის ყველაზე დიდი დიზაინი, რომელიც შემიძლია წარვადგინო AmpliSeq for Illumina მილსადენისთვის?

თქვენ შეგიძლიათ 500 კბ-მდე დიზაინის წარდგენა პირდაპირ მილსადენში. მილსადენი არის შეუძლია დიზაინის დამუშავება 5 მბ-მდე, მაგრამ ასეთი დიზაინები ძვირია და იკავებს გამოთვლითი რესურსების დიდ რაოდენობას.

ჩვენ გირჩევთ, რომ წარადგინოთ მხოლოდ 2 მბ-მდე დიზაინი. 2 მბ-დან 5 მბ-მდე დიზაინისთვის, გირჩევთ დაუკავშირდეთ გაყიდვების სპეციალისტს.

რა პანელები შემიძლია გამოვიყენო ახალ დიზაინში ამპლიკონების დასამატებლად?

თქვენ შეგიძლიათ დააკოპიროთ ამპლიკონები მორგებული, საზოგადოებიდან და ფიქსირებული AmpliSeq Illumina პანელებისთვის იმავე სახეობის გამოყენებით, როგორც თქვენი დიზაინი. ხელმისაწვდომი საზოგადოებისა და ფიქსირებული პანელების შესახებ ინფორმაციისთვის დაუკავშირდით Illumina-ს ტექნიკურ მხარდაჭერას.

DesignStudio - Primer Bioinformatics

როგორია პრაიმერებს შორის გადახურვის დონე?

პრაიმერები იმავე აუზში/მილაკში არ ემთხვევა ერთმანეთს.

AmpliSeq for Illumina პროექტებით DesignStudio-ში, არის თუ არა პრაიმერის კომპლექტების დიზაინი ავტომატურად (კომპიუტერული პროგრამით), მკვლევარი მეცნიერის დაკითხვის გარეშე?

პროცესი არის ავტომატური მილსადენი, ოპტიმიზირებულია მაქსიმალური დაფარვის უზრუნველსაყოფად სანდო პრაიმერის კომპლექტებით.

DesignStudio - ოლიგო შეკვეთა

შემიძლია კიდევ რამდენიმე გენის დამატება ადრე შეკვეთილი პრაიმერების კომპლექტს?

არა. თქვენ უნდა შეცვალოთ დიზაინი, დაამატოთ ახალი გენები და წარადგინოთ ახალი შეკვეთა.

თუ მე მაქვს რეგულარული პრაიმერები რეგიონისთვის და ვიცი, რომ ისინი მუშაობენ, შემიძლია თუ არა მათი დამატება ჩემს AmpliSeq for Illumina დიზაინისთვის?
შემიძლია ხელით დავამატო პრაიმერები, პოსტდიზაინი, რომ მთლიანად დაფაროს რეგიონი?

არა. ჩვენ ვიყენებთ სპეციალურად მოდიფიცირებულ პრაიმერებს, ამიტომ სტანდარტული პრაიმერები არ იძლევა ბიბლიოთეკის მშენებლობის საშუალებას.

არის AmpliSeq-ის მინიმალური შეკვეთა Illumina Gene-ისა და Hotspot-ის დიზაინებისთვის?

AmpliSeq Illumina-ს მორგებული პანელებისთვის მერყეობს 12 ამპლიკონიდან 3072 ამპლიკონამდე თითო აუზზე. სამიზნე რეგიონები შეიძლება იყოს 1 bp-მდე, მაგრამ რადგან დიზაინი უნდა შეიცავდეს 12 ამპლიკონს, დაგჭირდებათ 1 bp რეგიონების 12 კომპლექტი.

ყველა შეკვეთას აქვს მინიმალური ფასი, რომელიც ექვივალენტურია შეკვეთის ღირებულებისა, რომელიც შეიცავს 48 ამპლიკონს.

რა კონტეინერის ფორმატში უნდა ველოდები, რომ მივიღებ ჩემს მორგებულ პრაიმერებს?

თითოეული მორგებული პრაიმერის აუზი მიწოდებულია წინასწარ შეკრებილი მილის სახით.

როგორ შემიძლია გავარკვიო დიზაინის წარდგენის სტატუსი AmpliSeq-ზე Illumina Custom Panel-ისთვის?

ელ.წერილი [email protected] გამოიყენეთ თქვენი AmpliSeq Illumina Design-ის საიდენტიფიკაციო ნომრისთვის ან Solution ID ნომერი, როდესაც მიმართავთ თქვენს შეკვეთას.

DesignStudio - პრობლემების მოგვარება და დადასტურება

დავუშვათ, რომ მე მაქვს გამიზნული რეგიონი და DesignStudio გვთავაზობს დიზაინს, რომელიც შედგება ორი პრაიმერის აუზისაგან. თითოეული ნიმუშისთვის უნდა მოვამზადო ბიბლიოთეკა თითოეული გამაძლიერებლისთვის (თითოეული აუზი)? ანუ გავაერთიანო ორი გამაძლიერებელი (ორი გაძლიერებული აუზის პროდუქტები) და მერე მოვამზადო ბიბლიოთეკა?

თუ თქვენი დიზაინის შედეგად წარმოიქმნება მრავალი აუზი, თითოეული აუზი დამოუკიდებლად მუშავდება „დნმ-ის/cDNA სამიზნეების გაძლიერების“ მეშვეობით, როგორც ეს მითითებულია AmpliSeq for Illumina-ს მორგებული და საზოგადოების პანელის საცნობარო სახელმძღვანელოში. შემდეგ აუზები გაერთიანებულია „ნაწილობრივ დაიჯესტის ამპლიკონების“ საფეხურამდე. ისინი აგრძელებენ როგორც ერთ ნიმუშს ინდექსების ლიგაციისა და საბოლოო ბიბლიოთეკის გაძლიერების გზით.

რამდენი ბაზის წყვილი გამოყოფს პრაიმერებს სამიზნე რეგიონიდან?

იმისათვის, რომ დავრწმუნდეთ, რომ მთლიანი ეგზონი დაფარულია, ნაგულისხმევად, ჩვენ ვამატებთ 25 bp ბალიშს შერჩეული სამიზნე რეგიონის ზემოთ და ქვემოთ. ეს საფენი საშუალებას აძლევს ოთახს მოათავსოს პრაიმერები. ბალიშები უზრუნველყოფს მაღალი ხარისხის თანმიმდევრობას ეგზონების ბოლოებში და იძლევა გარკვეული თანმიმდევრობის საშუალებას შეერთების შეერთების რეგიონებში. პრაიმერის რეგიონები არ ითვლება დაფარულად. ამიტომ, თუ საწყისი დიზაინიდან მიღებული დაფარვა 100%-ზე ნაკლებია, ჩვენ შეგვიძლია კიდევ ერთხელ ვცადოთ პრაიმერის შემდგომი გახანგრძლივება ინტრონში, რათა დაიჭიროს მთელი ეგზონი.

შეყვანა

რა დნმ-ის შეყვანის რაოდენობაა საჭირო?

ანალიზი იყენებს 1-დან 100 ნგ-მდე დნმ-ს თითო პრაიმერის აუზზე, უმეტესი დიზაინი იყენებს 10 ნგს თითო აუზზე.

რა ხარისხის დნმ არის საჭირო და როგორ უნდა შეფასდეს დნმ-ის ხარისხი?

ჩვენ ვნახეთ წარმატება დაბალი ხარისხის შეყვანით მომხმარებლის სახელმძღვანელოში მითითებული პროტოკოლის ცვლილებების გამოყენებით. კომერციულად ხელმისაწვდომი ან ლაბორატორიულად დადასტურებული დნმ-ის ექსტრაქციის მეთოდები, როგორც წესი, იძლევა დნმ-ს, რომელიც თავსებადია ამ ანალიზთან. დნმ-ის სისუფთავეს უნდა ჰქონდეს A260/A280 თანაფარდობა 1.8-2.0. PicoGreen რეკომენდირებულია ზუსტი რაოდენობებისთვის.

მხარდაჭერილია FFPE ნიმუშები?

გამოიყენეთ FFPE-დან მიღებული დნმ მხოლოდ 140 ან 175 bp ამპლიკონის მოკლე სიგრძის გამოყენებისას. მოკლე ამპლიკონები უზრუნველყოფს უკეთეს გაძლიერებას, ვიდრე უფრო გრძელი, როდესაც ნიმუშის შეყვანა არის ფრაგმენტირებული FFPE-დან მიღებული დნმ.

რამდენი დნმ-ის დამიზნება შეიძლება ამ ნაკრებით?

თითო აუზზე არის 12-6144 პრაიმერის წყვილის ლიმიტი. თუ 5 მბ-ზე მეტი სამიზნე რეგიონის გენერირება ხდება, გირჩევთ აირჩიოთ გამდიდრების ვარიანტი.

Ოქმი

იყენებს თუ არა ეს ანალიზი სტანდარტულ Nextera ან TruSeq ადაპტერებს?

ამ ანალიზში გამოყენებული გადამყვანები ოპტიმიზებულია AmpliSeq სამუშაო ნაკადისთვის. Nextera ან TruSeq ადაპტერები არ არის თავსებადი ამ ანალიზთან.

რა არის საჭირო Illumina-სგან შესაძენად?
შემიძლია გავაკეთო ორი ან სამი განსხვავებული გაძლიერება და შემდეგ გავაერთიანო ისინი ბიბლიოთეკის მომზადებამდე?

შესაძლებელია 3 სხვადასხვა AmpliSeq-ის გაშვება Illumina-ს დიზაინისთვის, თითოეული შტრიხკოდებით იმავე თანმიმდევრობის პერსპექტივაზე. თუმცა, თქვენი სამიზნე ამპლიკონის ზომა და საჭირო დაფარვა უნდა იყოს მიღწეული ერთჯერადად.

თანმიმდევრობა

წაკითხვის რა სიგრძეა რეკომენდებული თანმიმდევრობისთვის?

2×150 bp დაწყვილებული ბოლო წაკითხვა რეკომენდებულია 140-275 bp ამპლიკონის ზომისთვის. MiSeq-ზე 2x300 bp-მდე დაწყვილებული ბოლო გაშვება რეკომენდებულია 375 bp ამპლიკონის ზომისთვის.

რამდენი ნიმუშის თანმიმდევრობა შეიძლება ერთდროულად?

ამ კომპლექტს აქვს ინტეგრირებული ნიმუშების შტრიხკოდები, რომლებიც იძლევა 96-მდე ნიმუშის გაერთიანებას ყოველი თანმიმდევრობის გაშვებაზე. თუმცა, ნიმუშების რეალური რაოდენობა, რომლებიც შეიძლება გაერთიანდეს ერთად თანმიმდევრობის გაშვებაზე, დამოკიდებულია ამპლიკონების რაოდენობაზე და თანმიმდევრობის დაფარვის სასურველ სიღრმეზე. ამ გამოთვლებში დასახმარებლად მოწოდებულია ონლაინ კალკულატორი DesignStudio-ში.

ანალიზი

რა ინსტრუმენტებს სთავაზობენ მონაცემთა ანალიზისთვის?

Local Run Manager-სა და BaseSpace Sequence Hub-ს აქვთ აპები, რომლებიც ხელმისაწვდომია ანალიზისთვის. დნმ ამპლიკონის ანალიზის აპლიკაცია და რნმ ამპლიკონის ანალიზის აპლიკაცია ხელმისაწვდომია BaseSpace Sequence Hub-ზე. შემდგომი ანალიზი შეიძლება განხორციელდეს ნებისმიერი ვარიანტის ზარზე BaseSpace Variant Interpreter-ის გამოყენებით. ლოკალური გაშვების მენეჯერს აქვს მსგავსი დნმ ამპლიკონის ანალიზის მოდული და რნმ ამპლიკონის ანალიზის მოდული, რომელიც იყენებს იგივე სამუშაო პროცესს და ალგორითმს, როგორც BaseSpace Sequence Hub აპები.

დნმ ამპლიკონის ანალიზის სამუშაო ნაკადი შეიძლება გამოყენებულ იქნას გასწორებისა და ვარიანტების გამოძახების შესასრულებლად და რნმ ამპლიკონის ანალიზის სამუშაო ნაკადი შერწყმის გამოძახებისთვის. გარდა ამისა, OncoCNV აბონენტი, BaseSpace Lab Apps ხელმისაწვდომია CNV ანალიზისთვის.

არის თუ არა ნიმუშის მონაცემები, რომლის ნახვა შემიძლია?

დიახ, არსებობს მონაცემთა ნაკრების მაგალითები BaseSpace Public Data-ში.

რა რეალური ანალიზის შესრულება შემიძლია ველოდოთ ჩემი დიზაინისგან?

DesignStudio აბრუნებს მაღალი ნდობის ამპლიქონის დიზაინებს, რომლებიც უზრუნველყოფენ ამპლიქონის მულტიპლექსირების უპრეცედენტო შესრულებას. ვინაიდან თითოეული დიზაინი უნიკალურია და ნიმუშის შეყვანა შეიძლება განსხვავდებოდეს, დიზაინის შესრულება საჭიროებს ემპირიულად შემოწმებას.

Are there non-encrypted manifest files available for my RNA panels (custom or fixed) containing fusions?

No. Manifest files for any RNA panel containing fusions are unavailable in a non-encrypted format. Only the encrypted manifest file is available.

Where can I find the breakpoint details for fusion panels (custom or fixed) included in the design?

Information about exact breakpoints contained in all RNA fusion panel designs is not provided. The result files produced by Illumina software analysis tools provide details of any RNA fusion events identified by the software. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

Where can I find my alignment files (eg, BAM files) from my analysis of RNA panels containing fusions?

Illumina software packages, including BaseSpace Sequence Hub Apps, do not provide alignment files as output from the analysis. At this time, only the final reporting of the results from the analysis are provided. For more details, consult the software's documentation.

Is there any information about potential false negatives or uncalled fusions from analysis of RNA panels containing fusions?

No. The software only reports detected fusion events. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

AmpliSeq for Illumina On-Demand

What is the minimum number of genes I can order in an On-Demand panel?

We’ve set an ordering minimum of 1 gene or 24 amplicons per panel. Designs must also have at least 2 pools and 12 amplicons per pool.

What is the maximum number of genes I can order in an On-Demand panel?

We have set an ordering maximum of 500 genes or 15,000 amplicons per panel due to manufacturing restrictions. We are always making improvements, so this limit is likely to increase. You may be able to order larger designs in the future.

What annotation source and version is used to recognize gene symbols when creating an On-Demand Panel?

Illumina uses RefGene v74 as the source of annotations.

Are untranslated regions (UTRs) included in an On-Demand gene’s design?

No, only the coding DNA sequence (CDS) region of a gene is included as part of an On-Demand gene design.

What is “Gene Amplicon Uniformity”?

Gene amplicon uniformity is the percentage of amplicons for a gene with greater than 0.2 times the mean coverage of all amplicons targeting that gene. It represents the observed wet-lab uniformity calculated from NextSeq data with the Illumina DNA Amplicon workflow.

Do On-Demand panels support UTR-only genes? What about pseudogenes?

No. On-Demand panels only support genes containing CDS regions. Pseudogenes are not supported.

What is the padding used for On-Demand gene designs?

The padding for every On-Demand gene design is 5 bp on the 5′ and 3′ ends of the exon.

Have all possible gene combinations been tested for primer-primer interactions?

No. The number of possible combinations is astronomical. It is not feasible to test for all possible combinations in the lab. However, through computer-based searches, we have reduced the occurrence of primer-primer interactions as much as possible. In addition, when synthesizing many genes simultaneously in large batches, we have observed less than 1% amplicon drop-out due to suspected primer-primer interactions.

Why are the number of primer pairs per pool indicated on the tube and box labels different than the number of amplicons per pool indicated in DesignStudio?

The number of amplicons per pool in DesignStudio reflects the number of unique amplicons in each pool. The number of primer pairs per pool on the tube and box labels reflects the total number of oligos per pool. Either value can be used when preparing libraries according to the AmpliSeq for Illumina On-Demand, Custom and Community Panels Reference Guide (Table 4. X cycles and X minutes). If the values fall into different cycle categories, the higher PCR cycle number is recommended.

AmpliSeq for Illumina On-Demand – IGV Viewer

What is the “observed coverage” track in the IGV viewer?

The “observed coverage” track indicates the number of observed reads for each amplicon of each targeted gene during validation experiments on a NextSeq. Use this track as general guidance for the likely performance when running an experiment. While values can vary among assays, the general coverage trend should remain consistent.

What are “Gaps”?

Gaps occur where there are no amplicons to provide coverage for the intended target. We have made every effort to minimize the occurrence of these regions in our On-Demand designs.

What is the scale on the Y-axis?

The Y-axis represents the observed coverage normalized by the mean amplicon coverage for the gene.

Can I use coordinates to navigate the IGV viewer?

No. The IGV viewer can only focus on your gene of interest. In the Grid View, select a gene, and the IGV viewer updates automatically to center on that gene.

I notice that the “observed coverage” track for an amplicon occasionally does not appear to contain information. Რატომ არის, რომ?

All amplicons in the design contain reads that are visualized in the “observed coverage” track. If the number of reads covering an amplicon is relatively small in comparison to neighboring amplicons, the “observed coverage” track appears empty. However, if you change the scale to a lower value, you will then be able to visualize the lower number of reads. If the observed coverage track is not present, the designer notifies you why that track is not available.

Დაგვიკავშირდით
Technical Support
Share With Tech Support

Get instructions for sharing your desktop while working with Technical Support.

Other Support
Დაგვიკავშირდით
Technical Support
[email protected]
Other Support

Innovative technologies

At Illumina, our goal is to apply innovative technologies to the analysis of genetic variation and function, making studies possible that were not even imaginable just a few years ago. It is mission critical for us to deliver innovative, flexible, and scalable solutions to meet the needs of our customers. As a global company that places high value on collaborative interactions, rapid delivery of solutions, and providing the highest level of quality, we strive to meet this challenge. Illumina innovative sequencing and array technologies are fueling groundbreaking advancements in life science research, translational and consumer genomics, and molecular diagnostics.

მხოლოდ კვლევის გამოყენებისთვის. არ გამოიყენება სადიაგნოსტიკო პროცედურებში (გარდა კონკრეტულად აღნიშნულისა).


COVER: აპრიორი estimation of coverage for metagenomic sequencing

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Შემაჯამებელი

In any metagenomic project, the coverage obtained for each particular species depends on its abundance. This makes it difficult to determine აპრიორი the amount of DNA sequencing necessary to obtain a high coverage for the dominant genomes in an environment. To aid the design of metagenomic sequencing projects, we have developed COVER, a web-based tool that allows the estimation of the coverage achieved for each species in an environmental sample. COVER uses a set of 16S rRNA sequences to produce an estimate of the number of operational taxonomic units (OTUs) in the sample, provides a taxonomic assignment for them, estimates their genome sizes and, most critically, corrects for the number of unobserved OTUs. COVER then calculates the amount of sequencing needed to achieve a given goal. Our tests and simulations indicate that the results obtained through COVER are in very good agreement with the experimental results.

ნახ. S1. The accuracy of the estimation of the fraction of 16S rRNA sequences belonging to unobserved OTUs (Good&aposs sample coverage). The results were obtained using a simulated data set composed of 16S rRNA sequences corresponding to 200 genomes, with abundances following a log-normal distribution (upper panel) or a broken-stick distribution (lower panel). Both distributions are used in ecology: the first is widely found in many natural communities, whereas the second is predicted for communities where the resources are partitioned into niches at random. Although microbial communities usually do not follow the broken-stick distribution, we wanted to test the performance of our calculation under this model of extremely high evenness. The insets show a rank-abundance graph showing the shapes of the respective distributions, with species ranked by abundance on the x-axis. The expected number of sequences is calculated using Good&aposs estimator, as described in the main text, whereas the real numbers are obtained by the random sampling of the number of sequences indicated by the x-axis.

ნახ S2. Accuracy of the estimation of unknown genome sizes. Upper: The difference in the genome size (expressed as |S1 − S2/max(S1, S2)|, with S1 and S2 representing the real sizes of the genomes) for pairs of genomes of known sizes, in relation to their taxonomic proximity. The relationship between the genome size and taxonomic relatedness is apparent. For instance, genomes related at the species level (i.e. different strains from the same species) usually have less than a 10% difference in genome size. If the genomes belong to the same genus, the difference can extend to 25%, although in most cases, it remains at 10% or less. Lower: Use of the genome sizes of sequenced species to infer the sizes for species currently being sequenced (species ‘in progress’ in the NCBI database, http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi, whose size has been estimated, usually via PFGE). The plot shows the probability of inferring the size correctly using the sizes of other species at different taxonomic ranks. For instance, the case marked by a dashed line in the plot corresponds to the estimation of the size of some species using the known sizes of other species from the same genus. In that case, there is an approximate 75% probability that we can infer its genome size with less than 10% error.

ნახ S3. Accuracy of the estimation of the 16S rRNA copy number. Differences in copy number (expressed as |C1 − C2/max(C1, C2)|, with C1 and C2 representing the numbers of 16S copies in the genomes) for pairs of genomes of known copy number, in relation to their taxonomic proximity.

ნახ S4. Variation of the estimated coverage in relation to the number of 16S rRNA sequences provided. A community of 100 species was simulated, and the estimated coverage for the first 10 members was calculated by COVER using different initial numbers of 16S sequences, supposing a sequencing effort of 500 000 reads of 400 base pairs each. It can be seen that the estimates of coverage oscillate greatly when few sequences are provided, indicating that the community composition is still not well determined. When a substantial amount of 16S sequences is provided (between 2000 and 3000, in this case), the estimated coverage values stabilize and are very similar to the real coverage values (last point in the plot).

Fig. S5. Results of the estimation of coverage for a controlled data set composed of 100 genomes, with abundances following a log-normal distribution. The results are obtained by simulating the sequencing of 500 000 reads of 400 bp each. The plot shows the real coverage for each species (red line) and the obtained coverage predicted by COVER (green points). Species (genomes) are sorted according their abundances. Estimated coverage values match the real values very well. Some instances have no coverage estimated. These species have been merged with closely related ones because the 16S identity for the related species is 98% or more. Მაგალითად, Burkholderia cenocepacia is given a coverage of zero because it was merged with Burkholderia pseudomallei, whose coverage is, thus, overestimated. Both species share 98% identity in their 16S rRNA. There was a similar occurrence for two more cases in this experiment: Bacillus anthracis was merged with Bacillus cereus, და Escherichia fergusonii was merged with ეშერიხია კოლი.

Table S1. Upper: Number of taxa for each rank, as listed in NCBI&aposs taxonomy database (http://www.ncbi.nlm.nih.gov/Taxonomy) and the number of taxa containing at least one member with known size (from either complete genomes, genomes in progress or genomes with PFGE size estimates, http://www.genomesize.com/prokaryotes). Lower: Presence of families without any members of known genome size in the environmental samples (http://metagenomics.uv.es/envDB). In a set of 3035 samples, 810 contain a member from one of these families.

Table S2. Results obtained for the estimation of the number of reads needed for obtaining coverage 5× for the most represented genome in a controlled data set composed of 300 genomes, with abundances following a log-normal distribution. For studying the influence of inaccurate estimations of genomic sizes, we allowed these sizes to vary by some percentage of their original values. We draw a random value between 0 and a given percentage of the estimated genomic size, and added or subtracted that value to the estimation. The results obtained allowing 20% and 50% of variation are shown. The values change around 10% when allowing 20% of variation in the estimated sizes, and barely 25% when allowing 50% of variation.

ცხრილი S3. Comparison of the real and expected results for two metagenomic sequencing projects. The metagenomes were kindly provided by Dr Alejandro Mira (CSISP, Valencia, Spain), and they consist of two coupled sets of 16S and metagenomic sequences from oral samples. The first was obtained by sequencing amplicons from clone libraries. The contig length distributions for the real and expected instances were calculated as described in the text.

Filename აღწერა
EMI4_338_sm_FigS1.jpg165 KB დამხმარე ინფორმაციის ელემენტი
EMI4_338_sm_FigS2.jpg207.5 KB დამხმარე ინფორმაციის ელემენტი
EMI4_338_sm_FigS3.jpg61.4 KB დამხმარე ინფორმაციის ელემენტი
EMI4_338_sm_FigS4.jpg93.6 KB დამხმარე ინფორმაციის ელემენტი
EMI4_338_sm_FigS5.jpg46.1 KB დამხმარე ინფორმაციის ელემენტი
EMI4_338_sm_TabS1.doc23 KB დამხმარე ინფორმაციის ელემენტი
EMI4_338_sm_TabS2.doc27.5 KB დამხმარე ინფორმაციის ელემენტი
EMI4_338_sm_TabS3.doc33.5 KB დამხმარე ინფორმაციის ელემენტი

გთხოვთ გაითვალისწინოთ: გამომცემელი არ არის პასუხისმგებელი ავტორების მიერ მოწოდებული ნებისმიერი დამხმარე ინფორმაციის შინაარსზე ან ფუნქციონალურობაზე. ნებისმიერი შეკითხვა (გარდა გამოტოვებული შინაარსისა) უნდა მიემართოს სტატიის შესაბამის ავტორს.